smear problem(have a picture of the gel) |
|
|
|
Topic Started by unguyan
on 3/24/2009 7:22 AM
|
|
NOW, THE PROBLEM HAVE BEEN SOLVED! ALL THE PROBLEM WAS THE TEMPLATES PROBLEM (NOT WASH CLEANLY).
THINK ALL OF YOU!
we are studying on early detection and therapy evaluation of schistosoma japonicum infection in a rabbit model by PCR.As you know, the quanlity of that schistosoma genomic DNA is very very low in the serum sample.And I think most of the extraction DNA are rabbit genomic DNA not schisitosoma genomic DNA.But the Positive control(extracted from schistosoma tissu ) in my gel is a very nice band.Now, I can see the Species-specific DNA band of serum sample in the gel.But I do not kown how to attenuate the smear. the length of target DNA: 230bp primer length: 21bp the sequence is:
P1: TCTAATGCTATTGGTTTGAGT
P2: TTCCTTATTTTCACAAGGTGA PCR reaction system (Takara): 10*buffer(tris-Hcl PH8.3 10mM;KCL 50mM)
dNTP 200uM
MgCl2 3mM
primer 0.4uM
Taq 2U
template 4ul(concentration don't kown)
ddH2O up to 25ul
94°3min then 94°60s—55°60s—72°60s 35cycles then 72° 7min end Could your please tell me how to kill the smear? thanks 
update at 09-3-29 12:22 
lane 1 to lane 7 (schisitosoma positive control): 25cycles, 30cycles, 31cycles, 32cycles , 33cycles, 34cycles, 35cycles lane 8 to lane 14 (blood sample 1, useing kit extraction): 25cycles, 30cycles, 31cycles, 32cycles , 33cycles, 34cycles, 35cycles lane 15 null lane 16 to 18 (blood sample 2, useing PCI extraction,35cycles):dilute at 1/1, 1/10, 1/50 lane 19 to 21 (blood sample 3, useing PCI extraction,35cycles):dilute at 1/1, 1/10, 1/50 lane 19 to 21 (blood sample 4, useing PCI extraction,35cycles):dilute at 1/1, 1/10, 1/50
update at 2009-3-27 
update at 2009-4-14 According to parvoman , vilsy and Ivan 's advice, I design a pair of new primers as follow: P1: TGTGGGAGTAGGCTGGAAG P2: TCGGAGGAAGACAAGGAGT
Alanyse my new Primers with Oligo 6 as follow:
Optimal Annealing Temperature: 54.1° (Max: 68.8°) --------------------------------------------------------------------
Position Length Tm [°C] GC [%] P.E.#
--------------------------------------------------------------------
Product ----- 216 84.8 48.1 48.1
Upper Primer 3483 19 67.3 57.9 390/390
Lower Primer 3680 19 65.8 52.6 381/381
-------------------------------------------------------------------- Product Tm - Lower Primer Tm: 18.9
Primers Tm difference: 1.5 Then run a PCR reaction, the results like this: 
Last edited Aug 15, 2009, 2:11 AM by unguyan
|
Replies
|
|
|
Posted By vilsy on 3/24/2009 7:28 AM
|
|
The smearing can be because of non specific binding of the primers to the DNA...whats the length of the primer that you are using? Did you blast them against the species antisense DNA to see the probability of such binding? In short, in my experience smear problem commonly arises from design problems with the primer
|
|
|
|
Posted By unguyan on 3/24/2009 7:46 AM
|
|
| vilsy said: |
The smearing can be because of non specific binding of the primers to the DNA...whats the length of the primer that you are using? Did you blast them against the species antisense DNA to see the probability of such binding? In short, in my experience smear problem commonly arises from design problems with the primer
|
this is my primer: P1: TCTAATGCTATTGGTTTGAGT
P2: TTCCTTATTTTCACAAGGTGA THANK YOU VERY MUCH!
Last edited Mar 24, 2009, 10:06 AM by unguyan
|
|
|
|
Posted By parvoman on 3/24/2009 16:01 PM
|
|
If your primer sequence is:
GACGTGGAGCTGGCCGAGGAGGCGC
then it should have an annealing temperature of about 72 degrees
If it is:
TTCCTTATTTTCACAAGGTGA, then it looks like 50.2 degrees.
My thoughts would be:
1. There are a lot of "T"s in the sequence and the 3' end is not a "C" or "G".
2. Do you get a smear when you omit the polymerase - ie. is the smear due to the input template?
3. I would usually try to order a primer with about 60% GC, avoid runs of As or Ts, and look to have a Tm of over 60 degrees, then select an annealing temp about 2 degrees below the theoritical temperature. If you get a smear then keep increasing the annealing temp until the band is produced without the smear. I would use a PCR machine with a gradient block.
|
|
|
|
Posted By unguyan on 3/24/2009 8:15 AM
|
|
| parvoman said: | | If your primer sequence is: GACGTGGAGCTGGCCGAGGAGGCGC then it should have an annealing temperature of about 72 degrees If it is: TTCCTTATTTTCACAAGGTGA, then it looks like 50.2 degrees. My thoughts would be: 1. There are a lot of "T"s in the sequence and the 3' end is not a "C" or "G". 2. Do you get a smear when you omit the polymerase - ie. is the smear due to the input template? 3. I would usually try to order a primer with about 60% GC, avoid runs of As or Ts, and look to have a Tm of over 60 degrees, then select an annealing temp about 2 degrees below the theoritical temperature. If you get a smear then keep increasing the annealing temp until the band is produced without the smear. I would use a PCR machine with a gradient block. |
Thanks ! though my english is very poor. First my primer sequence are:P1: TCTAATGCTATTGGTTTGAGT P2: TTCCTTATTTTCACAAGGTGA Second, I did not get a smear in the blank control(the templare is ddH2O) And the last,I have no acquaintance with the primer design. This primer is designed by my boss.
|
|
|
|
Posted By Ivan on 3/24/2009 8:40 AM
|
|
Hi unguyan, I second the advice given so far that you should try to avoid runs of A and T. Your primers are low in % GC content (only about 30% G and C) which can lead to mispriming (the annealing of your primers to DNA that is not the DNA you want to amplify: similar but not identical). If you do not have experience designing primers I advice you to start looking into some of the rules about primer design. For example a rough estimate of a primer's Tm (melting temperature, which you can use to estimate the annealing temperature of your PCR assay) can be calculated as follows: for every C or G add 4 degrees centigrade, and for every T and A add 2 degrees centigrade. So if you have a primer with 5 C, 5 G, 5 A and 5 T, the you get: (5 * 4) + (5 * 4) + (5 *2) + (5 *2) = 60 oC. Then as parvoman pointed out you simply subtract a couple of degrees (or more) to that melting temperature (in this case 60 - 2 = 58oC) and that is your annealing temperature. This is because at 60oC half of your primers are bound to your template and half are floating around; when you decrease the temperature more primers will be bound to your template (basic physical chemistry). Another thing to consider, since you pointed out that you are adding 4 ul of DNA template and you do not know the concentration of your DNA: you may be adding way too much DNA. The smear that you see could well be genomic DNA. While clean and un-degraded genomic DNA runs as a nice tight band at the top of an agarose gel, I've seen genomic DNA run like a smear just like what you see in your gel (typically when it is degraded, but not necessarily the case). If you can determine the concentration and quality of your DNA before running PCR (use a UV spectrophotometer and obtain readings at 260 and 280 nm, at least). If you have too much DNA then dilute it. If it is degraded I suggest you purify new DNA before running your PCR again. While primer design is very important for a successful PCR experiment, bad quality DNA (or too much of it) will surely make the experiment fail. Good luck
Ivan Delgado Orlic Carlsbad, CA
|
|
|
|
Posted By unguyan on 3/24/2009 9:21 AM
|
|
| Ivan said: |
Hi unguyan,
I second the advice given so far that you should try to avoid runs of A and T. Your primers are low in % GC content (only about 30% G and C) which can lead to mispriming (the annealing of your primers to DNA that is not the DNA you want to amplify: similar but not identical).
If you do not have experience designing primers I advice you to start looking into some of the rules about primer design. For example a rough estimate of a primer's Tm (melting temperature, which you can use to estimate the annealing temperature of your PCR assay) can be calculated as follows: for every C or G add 4 degrees centigrade, and for every T and A add 2 degrees centigrade. So if you have a primer with 5 C, 5 G, 5 A and 5 T, the you get: (5 * 4) + (5 * 4) + (5 *2) + (5 *2) = 60 oC. Then as parvoman pointed out you simply subtract a couple of degrees (or more) to that melting temperature (in this case 60 - 2 = 58oC) and that is your annealing temperature. This is because at 60oC half of your primers are bound to your template and half are floating around; when you decrease the temperature more primers will be bound to your template (basic physical chemistry).
Another thing to consider, since you pointed out that you are adding 4 ul of DNA template and you do not know the concentration of your DNA: you may be adding way too much DNA. The smear that you see could well be genomic DNA. While clean and un-degraded genomic DNA runs as a nice tight band at the top of an agarose gel, I've seen genomic DNA run like a smear just like what you see in your gel (typically when it is degraded, but not necessarily the case). If you can determine the concentration and quality of your DNA before running PCR (use a UV spectrophotometer and obtain readings at 260 and 280 nm, at least). If you have too much DNA then dilute it. If it is degraded I suggest you purify new DNA before running your PCR again. While primer design is very important for a successful PCR experiment, bad quality DNA (or too much of it) will surely make the experiment fail.
Good luck
|
Thank you very much for detailed explanation! I must to introduce my project first .we are studying on early detection and therapy evaluation of schistosoma japonicum infection in a rabbit model by PCR.As you know, the quanlity of that schistosoma genomic DNA is very very low in the serum sample.And I think most of the extraction DNA are rabbit genomic DNA not schisitosoma genomic DNA.But the Positive control(extracted from schistosoma tissu ) in my gel is a very nice band.Now, I can see the Species-specific DNA band of serum sample in the gel.But I do not kown how to attenuate the smear.
|
|
|
|
Posted By Ivan on 3/24/2009 10:03 AM
|
|
Your situation is definitely different then: you are trying to PCR amplify a DNA that is only a small percentage of the total DNA present in your sample. One way to get around this is to run a nested PCR: run your PCR using the same conditions as above, take a small aliquot of this first PCR assay and add it into a second PCR assay using a second set of primers that amplify within the amplicon generated by the first set. This should eliminate the smear since you essentially dilute it out while amplifying your PCR band by a whole new round of PCR. | unguyan said: |
Thank you very much for detailed explanation!
I must to introduce my project first .we are studying on early detection and therapy evaluation of schistosoma japonicum infection in a rabbit model by PCR.As you know, the quanlity of that schistosoma genomic DNA is very very low in the serum sample.And I think most of the extraction DNA are rabbit genomic DNA not schisitosoma genomic DNA.But the Positive control(extracted from schistosoma tissu ) in my gel is a very nice band.Now, I can see the Species-specific DNA band of serum sample in the gel.But I do not kown how to attenuate the smear.
|
Ivan Delgado Orlic Carlsbad, CA
|
|
|
|
Posted By parvoman on 3/24/2009 18:04 PM
|
|
Are you doing genomic DNA preps on rabbit blood?
If so, Are you doing any form of pre-purification to remove the majority of host blood cells - ficoll or percol gradients or dextran cushions. If you could remove most of the host blood cells, the genomic DNA prep would be greatly enriched for the blood flukes and you wouldn't have to use as much template in the PCR reactions.
I would also re-design the primers so that they have Tm of 60 degrees or over and run a number of PCR control reactions. For example, genomic DNA from uninfected rabbit blood to ensure that the primers are specific for the flukes.
Last edited Mar 24, 2009, 12:06 PM by parvoman
|
|
|
|
Posted By unguyan on 3/24/2009 18:33 PM
|
|
| parvoman said: | | Are you doing genomic DNA preps on rabbit blood? If so, Are you doing any form of pre-purification to remove the majority of host blood cells - ficoll or percol gradients or dextran cushions. If you could remove most of the host blood cells, the genomic DNA prep would be greatly enriched for the blood flukes and you wouldn't have to use as much template in the PCR reactions. I would also re-design the primers so that they have Tm of 60 degrees or over and run a number of PCR control reactions. For example, genomic DNA from uninfected rabbit blood to ensure that the primers are specific for the flukes. |
Yes,you are right.I did genomic DNA preps on rabbit blood by useing the Qiagen QIAamp DNA Blood Mini Kit. I also have tried to purify my template by using PCI method ,but both of them I only got a smear band as you saw .And I also run two PCR control reactions.One of it is the blank control(the templare is ddH2O),the other is Negative control(genomic DNA from uninfected rabbit blood ). 
Last edited Mar 24, 2009, 20:35 PM by unguyan
|
|
|
|
Posted By unguyan on 3/25/2009 0:15 AM
|
|
| Ivan said: |
Your situation is definitely different then: you are trying to PCR amplify a DNA that is only a small percentage of the total DNA present in your sample. One way to get around this is to run a nested PCR: run your PCR using the same conditions as above, take a small aliquot of this first PCR assay and add it into a second PCR assay using a second set of primers that amplify within the amplicon generated by the first set. This should eliminate the smear since you essentially dilute it out while amplifying your PCR band by a whole new round of PCR.
|
Thanks a lot. As you say,if I go to run a nested PCR that mean I must design another primer,right? I have tried to do second PCR: just take a small aliquot of the first PCR assay and dilute it into 10-2~10-5 times then add it into a second PCR assay using the same set of primers. And it not work. I got a more strong smear band. My boss will not agree to buy anoter set of primers. Is there no other way?
|
|
|
|
|
|
|
Unguyan,
You've gotten advice from three of the best we have here (Vilsy, Ivan, and Parvoman)! First I would totally back those guys up and say do a further isolation step on the blood and order some nested primers.
But it sounds like you got a complicated situation there unguyan. So lets try and work with what you have
Step 1 - You need to do what Parvoman first suggested; run a NO TAQ polymerase control, not a no template control. I suspect you are adding far too much DNA.
Set up a 'mock' PCR reaction but do not add the Taq polymerase, otherwise exactly like the ones that smear with the blood schistosoma DNA (no Taq Control). Run a 35 cycle PCR reaction. Run a gel. Do you get the smear? If yes, then reduce your template DNA added to the reaction by 10-fold, 100-fold, and 1000-fold and repeat the PCR as you described in your first post along with a NO TAQ control as described above. If, no go to step 2.
Step 2 - Set up your PCR in triplicate (as determined by Step 1). Remove one sample at 25 cycles, one at 30 cycles, and a final at 35 cycles. Run gel. Do you get the smear? Let us know what happens in these two tests and we will keep trying to help unguyan.
Rus
"Everything should be made as simple as possible, but no simpler." -- Einstein
|
|
|
|
Posted By unguyan on 3/25/2009 7:53 AM
|
|
| R Bishop said: |
Unguyan,
You've gotten advice from three of the best we have here (Vilsy, Ivan, and Parvoman)! First I would totally back those guys up and say do a further isolation step on the blood and order some nested primers.
But it sounds like you got a complicated situation there unguyan. So lets try and work with what you have
Step 1 - You need to do what Parvoman first suggested; run a NO TAQ polymerase control, not a no template control. I suspect you are adding far too much DNA.
Set up a 'mock' PCR reaction but do not add the Taq polymerase, otherwise exactly like the ones that smear with the blood schistosoma DNA (no Taq Control). Run a 35 cycle PCR reaction. Run a gel. Do you get the smear?
If yes, then reduce your template DNA added to the reaction by 10-fold, 100-fold, and 1000-fold and repeat the PCR as you described in your first post along with a NO TAQ control as described above. If, no go to step 2.
Step 2 - Set up your PCR in triplicate (as determined by Step 1). Remove one sample at 25 cycles, one at 30 cycles, and a final at 35 cycles. Run gel. Do you get the smear?
Let us know what happens in these two tests and we will keep trying to help unguyan.
Rus
|
谢谢!I will do it tomorrow. And I am very happy to see at here. Best wishes to you!
|
|
|
|
Posted By unguyan on 3/27/2009 6:57 AM
|
|
according to R Bishop's advice, the results has come out

1、blank control-----ddH2O
2、positive control----schistosoma tissu (no band?! Maybe the concentration is too low. I diluted it to 10-6)
3、sample one(no taq)----sample one useing PCI method extraction
4、sample one(add taq)
5、sample two(no taq)----sample two useing kit extraction
6、smaple two(add taq)
1 to 6 run 35 cycles
_________________________________________________________________________________________
7、smple one (add taq)
8、sample two (sdd taq)
7 and 8 run 25 cycles
__________________________________________________________________________________________
9、smple one (add taq)
10、sample two (sdd taq)
9 and 10 run 30 cycles
--------------------------------------------------------------------------------------------------------------------------------------------------------------
And I do another assay. The postive(schistosoma tissu, high concentration) is still no band after running a 25 cycles PCR reaction. It is too strange. When run a 35 cycles PCR reacation, the band is a very nice beam of light ). So I deduce that if I get the bood sample diluted, the smear maybe attenuate. Is it right? I will try it tomorrow. WOW, tomorrow is another day!
Last edited Apr 30, 2009, 12:01 PM by wenjun
|
|
|
|
Based off this gel, Id say you are correct Unguyan. Is the band in lane 7 the correct size though? I definitely agree the positive control was likely too dilute at 10-6.
Best
Rus
"Everything should be made as simple as possible, but no simpler." -- Einstein
|
|
|
|