Dear all
I am new to design primers. I am interested in putting NdeI and NcoI sites in my gene of interest in forward primer. The problem here is both have ATG sites and at the same time my gene of interest. So can any one design forward primer for this gene. Here is a short strech of gene.

ATGGCCCTCGCCTCGTAGCGCAAA

Ah primer designing!!!! I'm new to this forum but not primer designing. i do design some primer myself, so far still good. to answer ur question firstly u mention that u r new to primer design thus have u confirm that ur gene of interest cannot be cut by these 2 enzyme?

for ncoI = C'CATG_G
If you plan to express this gene why not find a plasmid that hv ncoI RE site for expression thus ur atg from be original from plasmid so ur forward primer will be

nnnccATGGCCCTCGCCTCGTAG [extra few bases i believe is good for the enzyme]


for ndeI = CA'TA_TG
reason same as above
nnncatATGGCCCTCGCCTCGTAG

currently i'm running a small scale free primer design site do visit research1stop.aka.my give me more detail maybe i can help out...

if putting link is not permitted i'm sorry moderator pls delete it. good day!!

This post is perfect. Thanks for helping. Thats what Scientist Solutions is all about!

Omai