Nikopoulos G, Adams T, Adams D, Oxburgh L, Prudovsky I, Verdi J. The use of Endo-Porter to deliver morpholinos in kidney organ culture. Biotechniques. 2008 Apr;44(4):547-9.

A paper in Biotechniques explores the use of Endo-Porter to deliver Morpholinos into kidney organ culture, prompting this description of the use of Endo-Porter in complex tissues. Endo-Porter was developed as a Morpholino delivery system for cultured cells, in which all cells would be in contact with the same concentration of Endo-Porter and oligo. This report shows that Morpholinos and Endo-Porter penetrated into the tissues and delivered not just to the surface layer of cells but also into some deeper layers, in a system where concentration gradients will form as the oligo and delivery reagent diffuse into the intercellular spaces in the tissues.

Nikopoulos et al. cultured embryonic mouse kidneys (at stage E11.5) on polycarbonate filters in Netwell wells and fed them with Richter’s Modified IMEM and holo-transferrin. The explants were fed without submerging them in the medium by soaking the medium up through the filter. Explants were incubated at 37C under 5% carbon dioxide.

They targeted NRAGE with a translation-blocking Morpholino (GGTTTCTGAGCCATAGCTCTCGTC), comparing its effects with a standard control Morpholino. Morpholinos were used at 10 microMolar and Endo-Porter was used at 4 microMolar. Their Figure 1 shows a time-dependent decrease in the NRAGE signal on a western blot at 12hr, 24hr, 48hr and 72hr after treatment commenced with the NRAGE Morpholino and Endo-Porter, compared with several 72hr control lanes: no treatment, NRAGE Morpholino but no Endo-Porter, and a standard control oligo with Endo-Porter. Only the lanes treated with the NRAGE Morpholino and Endo-Porter showed knockdown of the NRAGE signal, with the NRAGE signal nearly gone by 72hr. NRAGE signals were compared with beta-actin signals as a loading control.

The distribution of Morpholino uptake in the explants was determined by delivering a fluoresceinated standard control oligo with Endo-Porter under similar conditions to the knockdown experiment, followed by imaging optical sections of the explant with a confocal microscope. The fluorescein signal was observed in top, middle and bottom optical sections of the kidney explants. Without fluoresceinated-Morpholino treatment, similar optical sections were observed to control for autofluorescence, which was not visible in the control images.