Need a Control for PCR! [View Printable]
|
Amtekoth
Group: Moderators
Posts: 273
Joined: Apr 02, 2007
|
Hi,
I'm looking for a housekeeping gene that I can use for Q-PCR and RT-PCR that I can see the difference between human and mouse! I found some GAPDH primers that can distinguish between the size of the amplicons, but I can't seem to find a set of GAPDH primers (or any other gene) that will be positive for human but not mouse. And they can't be organ specific, since I need this for multiple tissues.
Help!
Ed |
.........................
"God put me on this earth to accomplish a certain number of things. Right now I am so far behind that I will never die."- Bill Watterson
|
 Posted Jan 30, 2008, 18:36 PM |
|
|
|
Marina Fomin
Group: Member
Posts: 46
Joined: Feb 28, 2006
|
Hi,
I have tested a lot of human houskeeping genes on great panel of human organs. For me, the best results were obtained with 18s rRNA gene. If you want I can send you the primer sequence and you can check that they don't recognize mouse seq. |
.........................
|
| Posted Jan 30, 2008, 20:36 PM |
|
|
|
Amtekoth
Group: Moderators
Posts: 273
Joined: Apr 02, 2007
|
| Marina Fomin said: | Hi,
I have tested a lot of human houskeeping genes on great panel of human organs. For me, the best results were obtained with 18s rRNA gene. If you want I can send you the primer sequence and you can check that they don't recognize mouse seq. |
Great, thanks! Please either post here or send me a PM. Or send me an email: labbratz -at- hotmail -dot- com (insert symbols) Ed |
.........................
"God put me on this earth to accomplish a certain number of things. Right now I am so far behind that I will never die."- Bill Watterson
|
| Posted Jan 30, 2008, 23:04 PM |
|
|
|
Marina Fomin
Group: Member
Posts: 46
Joined: Feb 28, 2006
|
Hi! Here they are
18S rRNA forward 5- TTCGGAACTGAGGCCATGAT 1842-1861
18S rRNA reverse 5- CGAACCTCCGACTTTCGTTT 1992-1973
gi22760900 151bp
Good luck! |
.........................
|
| Posted Jan 31, 2008, 19:40 PM |
|
|
|
Amtekoth
Group: Moderators
Posts: 273
Joined: Apr 02, 2007
|
| Marina Fomin said: | Hi! Here they are
18S rRNA forward 5- TTCGGAACTGAGGCCATGAT 1842-1861
18S rRNA reverse 5- CGAACCTCCGACTTTCGTTT 1992-1973
gi22760900 151bp
Good luck! |
Thanks, Marina, but a BLAST search came up 100% positive for mouse and human for both primers, at approximately the same distance apart, so they likely amplify the same size amplicon in both species. So that won't work for me. But thanks for trying. Anyone else? Ed |
.........................
"God put me on this earth to accomplish a certain number of things. Right now I am so far behind that I will never die."- Bill Watterson
|
| Posted Jan 31, 2008, 23:16 PM |
|
|
|
Marina Fomin
Group: Member
Posts: 46
Joined: Feb 28, 2006
|
Sorry Ed, it didn't help. But I am looking now many publication about transplantaiton of human cells into mouse. If I will find something inetersting I will let you know.
BTW, I like your comics, I check for new one daily. |
.........................
|
| Posted Jan 31, 2008, 22:05 PM |
|
|
|
Amtekoth
Group: Moderators
Posts: 273
Joined: Apr 02, 2007
|
Thanks, Marina. I've contacted RealTimePrimers.com. They sell Human and Mouse Housekeeping gene primer sets and I asked them if they were species specific.
Ed |
.........................
"God put me on this earth to accomplish a certain number of things. Right now I am so far behind that I will never die."- Bill Watterson
|
| Posted Feb 01, 2008, 1:17 AM |
|
|
|
Refer a Friend
Link To Us
Bookmark Us