Anybody ever did PCR with very long primers, like 50bp? The pair of the primers are very different. One is 24 bp. Another has 52 bp, with the overhang of 28bp. Tried several time but not successfully. Any expert knows how to make it work? Thanks in advance!

When you say that the PCR doesn't work, does this mean you get nothing on the gel, a smear, or the wrong sized band?

How many G/C and A/T do you have annealing in the first round of the PCR for each primer?

Knowing this I would consult an annealing table I have (because the 4 and 2 rule is too unreliable). It gives the temperature at which 50% of the primer binding sites will be bound so I'd drop the temperature about 1 degree below this.

Also you might think about using a slower than normal temperature ramp from the 95 degrees to the annealing temperature just calculated.

If you have a PCR machine with a gradient block then it's probably a good idea to run a number of samples (usually up to 12) with annealing temperature varying between Tm-5 degrees to Tm+15 degrees - then you'll see when you get the most efficient annealing.

Remember that in subsequent rounds of PCR, the longer oligo will be annealing before the shorter one since the template will be derived from an earlier PCR product that includes the long oligo's complementary sequence.

If you post the (1st round annealing) GC and AT content (eg. 18:12 respectively) for each primer I'll check it on my table and post what I get

PM

Thank you so much, Parvoman! In the first cycle, the short primer(TCCAGCCTCTGCGCCAGACCTATC): GC 62%; the long primer(GCGCGGTCTCAGTATGCTATACGAACGGTA-CATTTATTATTTCCTTCCTCTT): GC 27%.

I got nothing on the gel except primer dimer. I do want to try it again this weekend on a gradient block with annealing temperatures you suggested. Thx a lot!

LM

Hi again,

I just read your initial posting again and realised that the 28bp overhang is the GC rich bit and the annealing bit has all those TAs! So there's no point in doing an initial cycle at a higher temp. I'll post again with something (hopefully) more helpful.

Just checked the table and it gave:

short primer: Tm=65.3

Long primer (just the annealing bit): Tm=48.3


So for the PCR I would normally knock 2 degrees off of each and select the lowers temperature. But, for the long primer you will need to allow for a) the fact that the annealing bit has a very low GC content, b) there is an 11 nucloetide stretch of AT which lowers stability and c) there's a large non-annealing 28nuc stretch getting in the way too.

Basically, if you can redesign the 3'portion of the long primer this would help. If you can't then I would set up the PCR with just the long primer in it. Set a Tm for the first cycle of between 35 and 50 degrees in a gradient block then add in the shorter primer to each tube just after the first extention is finished. And of course, keep your fingers crossed too.

PM

Thanks a lot, Parvoman! I did the pcr with gradient annealing temperatures(50-60 degree), even tried with another set of pcr with concentations of magnesium at 54 degree. What I got is some smear streaks on the gel, seeming to be very unspecific amplification. Very weird!

Now I incline to believe the overhang of the primer may be a big problem. I'll try the addition of primers one by one for the last time. If it still refused to work, I will go to new primers. Thank you so much!

LM

OK, good luck. Just to recap in case my last post was unclear:




Gradient Cycler:

Cycle 1: Annealing at between 35 and 50 with no short primer present

Add the short primer

Cycle 2-35: Annealing temp at 62 degrees

Try using modified bases such as 2,6 diaminopurine, 2-Methyl dT on your shorter Oligos. The modifications will increase the Tm and thus bring it closer to the tm of the longer oligo. The tm of the longer oligo is closer to 72 C.