Award
 » Home » Molecular Biology » DNA/RNA » tRNA sequences and structures?
 
Solutions Search! The Customized Life Science Search Engine
Search Site
Search Suppliers
Search Internet
Search over 6000 life science websites specifically selected by our expert scientist moderators.

Other Topics
9/30/2008 07:49 PM
Methylene Blue DNA Staini ...
9/25/2008 11:27 AM
DNA protein interaction m ...
9/25/2008 11:40 AM
RNA DNA purification
9/14/2008 04:44 AM
RNA isolation from bone
9/9/2008 04:37 PM
RNA from platelets
9/3/2008 01:22 PM
Specificity of taq for RN ...
9/1/2008 03:05 AM
RNA Electrophoresis
8/29/2008 02:47 AM
Standardize herbal extrac ...
7/31/2008 03:37 PM
Solexa sequencing of PCR ...
7/21/2008 03:49 AM
RNA thermal and pH stabil ...
7/11/2008 01:42 PM
Reverse transcription usi ...
7/10/2008 02:21 PM
Who makes the best VALUE ...
7/10/2008 10:06 AM
sybr safe
6/23/2008 08:58 AM
How many Neuts for a tota ...
4/2/2008 02:15 PM
DNA storage
3/26/2008 03:10 PM
DNA sequencing
3/10/2008 10:40 AM
comet assay
2/18/2008 04:46 PM
Need Help with Transfecti ...
2/14/2008 01:42 AM
Storing DNA
2/8/2008 01:25 PM
RiboGreen
2/1/2008 07:33 PM
Unnatural Base Pairs Disc ...
1/19/2008 05:24 AM
Isolation of DNA bands fr ...
11/20/2007 11:41 PM
The U12 splicosome functi ...
11/13/2007 11:04 AM
Need Genotypic Characteri ...
10/8/2007 01:18 PM
insertion with Pjet
10/8/2007 09:46 AM
EXTRACTING TB DNA FROM MO ...
10/1/2007 12:08 PM
DNA extraction from green ...
10/1/2007 11:03 AM
DNA Extraction is failed
8/29/2007 09:11 AM
pGEX-2T GST fusion vector
8/24/2007 07:42 PM
Taq polymerase patents
Subscribet to topic
bottom of page RSS Feed Topic Feed
 tRNA sequences and structures? [View Printable]
Migle

Frog Egg

See
Similar
Scientists





Group: Member
Posts: 7
Joined: May 21, 2007







 Send a personal messsage to Migle Reply with a quote from this post Go to the top of the page

E.coli strains ment for eucarial/archaeal protein expression have additional certain tRNA copies. In manuals by the strains' suppliers the tRNAs are designated, for example, ileX, ileW, leuY, etc. But I was unable to find the sequences of the RNAs by these designations in any database. And what I particularly need are the structures of tRNAs ileY and ileX. Or at least the sequences.
I will greately appreaciate any comments and help.
Thank you in advance!
.........................

 Posted May 21, 2007, 12:27 PM
frasermoss

Frog Laureate

See
Similar
Scientists





Group: Admin
Posts: 613
Joined: Feb 22, 2005







 Send a personal messsage to frasermoss Reply with a quote from this post Go to the top of the page

you can find a lot of the sequences here


http://genome.naist.jp/bacteria/o157/rna.html

some quick sequences

>ileY
TGGTGGCCCTTGCTGGACTTGAACCAGCGACCGGACGATTATGAGTCGCCTGCTCTAACC
ACTGAGCTAAAGGGCC

>ileX
GGCCCCTTAGCTCAGTGGTTAGAGCAGGCGACTCATAATCGCTTGGTCGCTGGTTCAAGT
CCAGCAGGGGCCACCA

There is a program called loop P that you can use to map structures.

.........................
"Opportunity is missed by most people because it is dressed in overalls and looks like work". Edison

Posted May 21, 2007, 15:52 PM
Tony Rook

Moderator

See
Similar
Scientists



View Blogs


Group: Member
Posts: 582
Joined: Nov 03, 2005







 Send a personal messsage to Tony Rook Reply with a quote from this post Go to the top of the page



Here are some other resources...



Compilation of tRNA sequences and sequences of tRNA genes - September 2004 edition

The new compilation of tRNA Sequences and Sequences of tRNA genes contains in addition to 3279 sequences of the last edition from 1998 (1) the completely new Genomic tRNA Compilation including the sequences of tRNA genes from complete genomes published up to september 2004. The current Database consists of three parts:

1. Genomic tRNA Compilation (MS Excel file, ZIPed)
2. Compilation of tRNA Sequences (MS Excel file, ZIPed)
3. Compilation of tRNA Genes (MS Excel file, ZIPed)

Genomic tRNA Compilation - this is the compilation of the sequences of cytoplasmic tRNA genes derived from sequences of complete genomes included into DNA databases. Since sequences of tRNA genes originating from cellular organelles frequently can not be processed to the general cloverleaf scheme, they were not included in the Genomic tRNA Compilation. There are specialised databases dealing with these sequences (see links below).

Current Genomic tRNA Compilation consists of about 7600 tRNA gene sequences from 131 organisms covering archaea, bacteria, higher and lower eukarya. The database includes the tRNA genes sequences collected in GtRDB (2) as well as those from the additional complete genomes found in DNA databases. tRNA genes were identified by sequencing teams using common tRNA search programs [a.g. tRNAScan (2)]. If the genomes of the different strains of the same organism were sequenced, the corresponding tRNA genes were added to the database independently.

Compilation of tRNA Sequences - is a summary of tRNA sequences, including modified bases and references of the publications. The references are restricted to the first publication of the complete sequence unless additional information (e.g. base modification, corrections, etc.) was later obtained. In such cases additional references were added. This compilation is updated up to August 2003. The table contains the known tRNA sequences of all organisms including organells. This is the continuation of the original tRNA compilation first published in 1978.

Compilation of tRNA Genes - is a summary of the sequences of individual tRNA genes published or included to databases up to the end of 1998. It contains tRNA genes of all organisms and organels, but is not updated since January 1999. This table contains about 350 sequences of cytoplasmic tRNA genes that are not included in the Genomic tRNA Database. Most of the tRNA gene entries in this table have references of the publications in which the sequence was communicated.




tRNA Compilation 2000

Based on - Compilation of tRNA sequences and sequences of tRNA genes, September 2004 edition




G~tRNA~db: The Genomic tRNA Database

Introduction:
This genomic tRNA database contains tRNA identifications made by the program tRNAscan-SE (Lowe & Eddy, Nucl Acids Res 25: 955-964, 1997) on complete or nearly complete genomes. Unless otherwise noted, all annotation is automated, and has not been inspected for agreement with published literature.

Inevitably with automated sequence analysis, we find exceptions to general identification rules, isoacceptor type predictions (esp. due to variable post-transcriptional anticodon modification), and questionable tRNA identifications (due to pseudogenes, SINES, or other tRNA-derived elements). We attempt to document all cases we come across, and welcome feedback (lowe @soe.ucsc.edu) on new or unrecognized discrepancies. For a more detailed description of information in tables and the tRNA search algorithm.




The RNA Modification Database

The RNA modification database provides a comprehensive listing of posttranscriptionally modified nucleosides from RNA and is maintained as an updated version of the initial printed report:

P.A. Limbach, P.F. Crain and J.A. McCloskey. Summary: the modified nucleosides of RNA. Nucleic Acids Res. 22, 2183-2196 (1994).

Both the structural diversity and extent of posttranscriptional modification in RNA is remarkable [1], with 96 different nucleosides presently known in all types of RNA. The discovery of new modified nucleosides as well as increasing knowledge of the array of functional roles of modification, based largely on extensive studies of tRNA [2-5], mandates a need for a comprehensive database of RNA nucleosides. The RNA Modification Database is maintained as an extension of the initial version published in mid-1994 [1]. The database consists of all RNA-derived ribonucleosides of known structure, including those from established sequence positions, as well as those detected or characterized from hydrolysates of RNA. The information provided permits access to the modified nucleoside literature through provision of both computer-searchable Chemical Abstracts registry numbers and key literature citations.




Compilation of mitochonridial mammalian tRNA genes

Mamit-tRNA is a gene compilation aimed at defining typical as well as consensus primary and secondary structural features of mammalian mitochondrial tRNAs. It contains presently 679 tRNA gene sequences from 31 fully sequenced mammalian mitochondrial genomes. These are classified into 22 families according to the amino acid specificity as defined by the anticodon triplets. For each family, a vertical alignment based on the search of common secondary structural domains is presented as well as "typical" and "consensus" cloverleaf structures. Discussion of structural characteristics as deduced for each of the 22 tRNA families is included in Helm, M., Brulé, H, Friede, D, Giegé, R, Pütz, J and Florentz, C. (2000), RNA, Vol. 6, pp 1356-79.

Mamit-tRNA, to be updated regulary, is expected to serve as basis towards the deciphering of structural features of mammalian mitochondrial tRNAs as well as towards the understanding of human diseases linked to point mutations in mitochondrial tRNA genes.

.........................
Tony Rook

Posted May 21, 2007, 21:14 PM
Migle

Frog Egg

See
Similar
Scientists





Group: Member
Posts: 7
Joined: May 21, 2007







 Send a personal messsage to Migle Reply with a quote from this post Go to the top of the page

Thank you very much!

I have found what I asked for in the database http://genome.naist.jp/bacteria/o157/rna.html

But I am still having problems with these sequences:

IleY is said to have an anticodon CAU (CAT), but I can't see it in the sequence:

>ileY
TGGTGGCCCTTGCTGGACTTGAACCAGCGACCGGACGATTATGAGTCGCCTGCTCTAACCACTGAGCTAAAGGGCC

Any comments?..
.........................

Posted May 22, 2007, 14:30 PM
frasermoss

Frog Laureate

See
Similar
Scientists





Group: Admin
Posts: 613
Joined: Feb 22, 2005







 Send a personal messsage to frasermoss Reply with a quote from this post Go to the top of the page

Isn't it the ATG at position 41 to 43 in your sequence?

don't forget to reverse complement! Its at positions 37-39 once you do

TACGGCCCTTTAGCTCAGTGGTTAGAGCAGGCGACTCATAATCGTCCGGTCGCTGGTTCAAGTCCAGCAAGGGCCACCA
.........................
"Opportunity is missed by most people because it is dressed in overalls and looks like work". Edison

Posted May 22, 2007, 23:08 PM
Migle

Frog Egg

See
Similar
Scientists





Group: Member
Posts: 7
Joined: May 21, 2007







 Send a personal messsage to Migle Reply with a quote from this post Go to the top of the page

I see.

But what about ileX then? This one seems not to need reverse complementing:

>ileX
GGCCCCTTAGCTCAGTGGTTAGAGCAGGCGACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCA

Is it so because ileY and ileX are on different strands of the genome and the database presents only one strand?
.........................

Posted May 23, 2007, 6:02 AM
frasermoss

Frog Laureate

See
Similar
Scientists





Group: Admin
Posts: 613
Joined: Feb 22, 2005







 Send a personal messsage to frasermoss Reply with a quote from this post Go to the top of the page

When looking at tRNA make sure the 3' end ends with CCA then you know you are looking at it correctly.

If you're looking at the genomic DNA then you are most probably correct about why some are presented in sense and others in anti sense in the database.
.........................
"Opportunity is missed by most people because it is dressed in overalls and looks like work". Edison

Posted May 26, 2007, 2:59 AM
top of page

Forum Jump