Need technique to know which protein isoform is expressed in Dro. muscle?

12 posts / 0 new
Last post
S.A.D.
S.A.D.'s picture
Need technique to know which protein isoform is expressed in Dro. muscle?

I'm working with the Drosophila larvae as my model system.

My gene of interest makes five predicted polypeptide isoforms and I am trying to determine which of these isoforms is being expressed in the larval muscle cells. All these isoforms differ from each other in only the C-terminus, otherwise they have identical sequences. Their MW are in range of 115-130 kDa.

Does anyone have a good idea of what technique I can use to identify which of these five isoforms is being expressed in the muscle?

I tried Western Blotting, but the Ab we have recognises the N-termius, and it doesnt discriminate one isoform from another. I just see one single band. Someone else had mentioned PCR but I dont know how exactly to go about it.

Anyone have a good strategy and/or protocol?

Thanks

R Bishop
R Bishop's picture
S.A.D.,

S.A.D.,

"My gene of interest makes five predicted polypeptide isoforms and I am trying to determine which of these isoforms is being expressed in the larval muscle cells. All these isoforms differ from each other in only the C-terminus, otherwise they have identical sequences. Their MW are in range of 115-130 kDa."

Are the C-terminal different splice forms or protease cleaved? If they are splice forms qRT-PCR is the best way to get the answer. Ive done this for CD44 which has many splice forms. If this is the case let me know and I'll walk you through the whole set up from designing primers through detection of RNA products.

If its protease or autocleaving, outside of specific antibodies to each isoform I have no idea how to proceed. You are right though you will never detect the the forms by a single anitbody by western blot.

Rb

S.A.D.
S.A.D.'s picture
Thanks so much for your

Thanks so much for your prompt response

Yes, the different isoforms are splicing variants and I would greatly appreciate if you could walk me through the procedure

Thanks once again

SAD

R Bishop wrote:

S.A.D.,

"My gene of interest makes five predicted polypeptide isoforms and I am trying to determine which of these isoforms is being expressed in the larval muscle cells. All these isoforms differ from each other in only the C-terminus, otherwise they have identical sequences. Their MW are in range of 115-130 kDa."

Are the C-terminal different splice forms or protease cleaved? If they are splice forms qRT-PCR is the best way to get the answer. Ive done this for CD44 which has many splice forms. If this is the case let me know and I'll walk you through the whole set up from designing primers through detection of RNA products.

If its protease or autocleaving, outside of specific antibodies to each isoform I have no idea how to proceed. You are right though you will never detect the the forms by a single anitbody by western blot.

Rb

R Bishop
R Bishop's picture
Ok Im going to outline this

Ok Im going to outline this in stages then post the entire protocol to the protocols section for printing.

You can use regular PCR, but qPCR is preferred. I use a Stratagene MX4000, but any machine will work.

Your first step is the most important. You need to design primers that can detect the splicing differences. This is a little tricky because I cant see your gene of interest, so Im firing blind a bit. If you want to disclose it, I will help you specifically.

What I do is first find the complete genomic sequence of the gene. Im not sure the best database for flies, maybe flybase? You want to find the EXONS that encompass the region with alternative splicing. Your goal is to design intron spanning primers that can distinguish the 5 splice variants. So I typically make one common primer for all 5 variants, then a second primer that is unique to each splice variant. This way you will end up with 6 total primers

1. Common and occurs in a separate exon from the splice site
2-6. A unique primer for each variant.

Intron spanning primers are required because you will just detect genomic DNA and not RNA if you use primers from the same exon.

Ok that is the concept for primer design. The next step is optimizing the primers for qPCR. Once I hear back from you I will post that step or go into detail on primer design with your gene.

Rusty

kriodos
kriodos's picture
I'm in agree with bishop

I'm in agree with bishop
qPCR is a good option (probably the best). If you know the differences in Isoelectric point you can make a IEF and transfer to a membrane.after performe a western blot and ceck the number and position of your isoforms. If you have a agood pattern you can get the isoelectric point and idetify it.
wrote:

S.A.D.
S.A.D.'s picture
Rusty,

Rusty,

Thank you so much for your response and willingness to help me step by step, I really appreciate it . I'm sorry I disappeared for a bit, but I'm back on this project now.

Ok, so I'll design the primers and even show you the ones I choose for one of the isoforms. I am referring to flybase, and they have the FASTA formats for the 6 predicted transcripts, and thats what I'll use to design the primers, they even have the FASTA formats for the 6 CDS, which I presume means Coding Sequences.

If I'm not mistaken, I could use either of the above for designing the primers, is that CORRECT?

I'll get back to you as soon as I'm done.

Thanks once again for all your help

SAD

R Bishop wrote:

Ok Im going to outline this in stages then post the entire protocol to the protocols section for printing.

You can use regular PCR, but qPCR is preferred. I use a Stratagene MX4000, but any machine will work.

Your first step is the most important. You need to design primers that can detect the splicing differences. This is a little tricky because I cant see your gene of interest, so Im firing blind a bit. If you want to disclose it, I will help you specifically.

What I do is first find the complete genomic sequence of the gene. Im not sure the best database for flies, maybe flybase? You want to find the EXONS that encompass the region with alternative splicing. Your goal is to design intron spanning primers that can distinguish the 5 splice variants. So I typically make one common primer for all 5 variants, then a second primer that is unique to each splice variant. This way you will end up with 6 total primers

1. Common and occurs in a separate exon from the splice site
2-6. A unique primer for each variant.

Intron spanning primers are required because you will just detect genomic DNA and not RNA if you use primers from the same exon.

Ok that is the concept for primer design. The next step is optimizing the primers for qPCR. Once I hear back from you I will post that step or go into detail on primer design with your gene.

Rusty

R Bishop
R Bishop's picture
Cool by me.

Cool by me.

Also I use this tool to design my primers
https://tools.invitrogen.com/content.cfm?pageid=9716

Get pretty solid results with it. However you will need to design the intron specific ones yourself. I think you have the idea down. Im ordering primers through ThermoFisher these days due to cost, where do you guys order from?

Rusty

S.A.D.
S.A.D.'s picture
Rusty,

Rusty,

Ok, I've finally gotten back to my project again. So I'll basically outline everything I did and then if you could just guide me that would be great. Thanks a billion for all your help, I really appreciate it.

So I designed these primers using the mRNA.
I tried sending the sequences to you as an attachment but was unable to do so, so I'm sorry about this, but if you go to FlyBase, and type in CG42314 or CG2165, then there you will be able to pull up the FastA formats for all 6 predicted mRNA transcripts.

Below is a note on the primers I designed with their sequence details.

I know you had mentioned about optimizing the primers for qPCR and that this was the most crucial stage. I have no idea how to do this so it would be great to have your help. If you could even guide me for one set of primers, that should be fine.

About ordering primers, we have never ordered it yet, cause we're a neuro group and do mostly physiology. But in my earlier lab where I got my Masters, we used to order oligos from Integrated DNA technologies. I dont know how that compares price wise with others.

Thank you once again for all your help and guidance. Sorry for the length of this as well.

S.A.D.

-----------------------------------------------------------------

I first designed one common primer for all the isoforms, this is at the 5' end of the mRNAs and is conserved in all.

What I happened to notice was that 2 of the 6 transcripts were identical, except for a little section near their 5' end.
These are FBtr0300554 and FBtr0300557. They even produce the same polypeptide sequence, so thats good.

FBtr0300555 and FBtr0300556 are completely identical at their 5' and 3' ends, only differ little somewhere in the middle.

Interestingly, the 3' end of all these four mRNAs, i.e. FBtr0300554/5/6/7 are completely conserved,
so I thought I could just design a single common primer at the 3' end for all four, and once I got their sequence after the PCR, I would know which one I was dealing with.

And then I went on to designing the 3' end primer for the remaining two mRNAs, FBtr0300558 and FBtr0300559.
------------------------------------------------------------------
The Common primer at the 5' end of the 6 mRNAs
5' - AACAAATGGCCACTATAGATGGAAGA - 3'

The 3' end primer for the mRNAs FBtr0300554, FBtr0300555, FBtr0300556 and FBtr0300557:

5'- ATTCATTGAATCATTTATTACATGTAAGACG - 3'
******************************************
The 3' end primer for FBtr0300558 is:

5'- AATAAGAATATCAATGGAAAAACCACATTTTTA - 3'
************************************************
The 3' primer for FBtr0300559 is:

5' - GAATACTATTCTTTTATTGCAATCATTGATTAT - 3'
*************************************************

R Bishop wrote:

Cool by me.

Also I use this tool to design my primers
https://tools.invitrogen.com/content.cfm?pageid=9716

Get pretty solid results with it. However you will need to design the intron specific ones yourself. I think you have the idea down. Im ordering primers through ThermoFisher these days due to cost, where do you guys order from?

Rusty

R Bishop
R Bishop's picture
SAD look at this diagram

SAD look at this diagram

R Bishop
R Bishop's picture
Now that Ive seen your gene,

Now that Ive seen your gene, I can better help you.

I would design a common 3' primer to all 6 splice forms of the gene in the middle exon indicated in the diagram above.

Then you need a unique 5' primer for EACH splice variant otherwise you cannot tell the variants apart by PCR.

You can find each splice variant exon using flybase.
First go to this link

http://flybase.org/reports/FBgn0259214.html

then in the pulldown boxes on the right side select CDS and click get FastA.

This will pull up this page
http://flybase.org/cgi-bin/getseq.html?source=dmel&id=FBgn0259214&chr=4&dump=PrecompiledFasta&targetset=CDS

From here you see all the mRNAs for the 6 variants. You can now search each variant at the UCSC genome browser.

Here
http://genome.ucsc.edu/cgi-bin/hgBlat

Then paste the coding sequence in the box, select D. melanogaster and hit submit. Your gene is the top one select BROWER.

Now you see the splice variants again. click on the first protein coding variant. you'll see this screen.
http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr4:349833-376092&db=dm3&ss=../trash/hgSs/hgSs_genome_306b_2b89e0.pslx+../trash/hgSs/hgSs_genome_306b_2b89e0.fa&hgsid=117605097

Click on the first coding variant. Brings you to this screen

Now select "Genomic Sequence (chr4:349,442-379,282)"
click submit and you will see the exons in caps and the introns in small letters. you should now be able to pick the exons, splice junctions, and make your primers.

This exon is common to all isoforms. Check me on this before designing though.

GTGGACGAATCTTCTCTGACTGGAGAGTCTGATCACGTCAAAAAGGGGCCAGATG
TTGATCCCATGGTTTTATCCGGCACGCATGTTATGGAAGGAAGCGGCAAA
ATGGTTGTTACAGCCGTAGGGGTAAACTCACAAGCTGGTATAATTTTTAC
GCTCCTTGGTGCGGCAGTTGACGAACAAGAAGCAGAAATTAAGAAGATGA
AAAAGG

Get back to me when you get the primers designed. Im off to ASCB until Thursday though. sorry.

Rb

S.A.D.
S.A.D.'s picture
Rusty,

Rusty,

Thank you very very much for both your previous posts.

Especially your last one, it was very kind of you to go step by step, and even putting the links etc, I would definitely have gotten lost somewhere along the way.

I'm ready to design the primers, just had two stupid questions to ask prior to that.

You had mentioned that when I design the primers they should be intron spanning primers so as to avoid just getting PCR off of the genome instead of the RNA. This is the thing I'm a little confused about.

So just as you showed in the diagram that you sent me earlier, theres one 3' primer that I will design for an exon that is common to all isoforms. And then I design a 5' primer specific to each isoform by using exons that are exclusive to that isoform and not found in the other isoforms.

Now since you said I should design intron spanning primers, does that mean the primer I design should cover partly that particular exon and partly the intron that follows?????

And you had mentioned that the intron spanning primers will exclude the genome, but the genome sequence contains all the exon and intron sequences anyways, so I didnt quite understand how we will manage to get PCR products that specifically amplify only the RNA and not portions of the genome, as far as I can think- for every PCR we should obtains two products - one off of the genome and the other off of the respective RNA (provided it is present).

If you could probably explain these two to me that would be great. And I'll get back to you by the end of the day with the primers I design just to make sure I'm on the right track.

Thanks a zillion for everything. I owe you big time.

S.A.D.

R Bishop wrote:

Now that Ive seen your gene, I can better help you.

I would design a common 3' primer to all 6 splice forms of the gene in the middle exon indicated in the diagram above.

Then you need a unique 5' primer for EACH splice variant otherwise you cannot tell the variants apart by PCR.

You can find each splice variant exon using flybase.
First go to this link

http://flybase.org/reports/FBgn0259214.html

then in the pulldown boxes on the right side select CDS and click get FastA.

This will pull up this page
http://flybase.org/cgi-bin/getseq.html?source=dmel&id=FBgn0259214&chr=4&dump=PrecompiledFasta&targetset=CDS

From here you see all the mRNAs for the 6 variants. You can now search each variant at the UCSC genome browser.

Here
http://genome.ucsc.edu/cgi-bin/hgBlat

Then paste the coding sequence in the box, select D. melanogaster and hit submit. Your gene is the top one select BROWER.

Now you see the splice variants again. click on the first protein coding variant. you'll see this screen.
http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr4:349833-376092&db=dm3&ss=../trash/hgSs/hgSs_genome_306b_2b89e0.pslx+../trash/hgSs/hgSs_genome_306b_2b89e0.fa&hgsid=117605097

Click on the first coding variant. Brings you to this screen

Now select "Genomic Sequence (chr4:349,442-379,282)"
click submit and you will see the exons in caps and the introns in small letters. you should now be able to pick the exons, splice junctions, and make your primers.

This exon is common to all isoforms. Check me on this before designing though.

GTGGACGAATCTTCTCTGACTGGAGAGTCTGATCACGTCAAAAAGGGGCCAGATG
TTGATCCCATGGTTTTATCCGGCACGCATGTTATGGAAGGAAGCGGCAAA
ATGGTTGTTACAGCCGTAGGGGTAAACTCACAAGCTGGTATAATTTTTAC
GCTCCTTGGTGCGGCAGTTGACGAACAAGAAGCAGAAATTAAGAAGATGA
AAAAGG

Get back to me when you get the primers designed. Im off to ASCB until Thursday though. sorry.

Rb

S.A.D.
S.A.D.'s picture
Rusty,

Rusty,

I've finally designed the primers !!!!!!!!!!!!!!!!

I truly appreciate your help but please do let me know if helping me out is inconveniencing you in any way.

So, if your at this site that you had given me earlier, you see all the six predicted isoforms of the protein:

http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr4:348129-374388&hgsid=118530396

For each isoform, I obtained the respective list of exons. All the isoforms are designated as CG42314 - RC/ RD/ RE/ RF/ RG/ RH.

RE and RG are identical and do not differ in any way. Exon #28 is common to all isoforms, Exon # 30 is the one that differs between RD, RF, and RH. Also exon # 30 for RE/RG is not found in RC.

If we are going from the 5' end to the 3' end, we find exon #28, then #30, etc .............

When designing the primers, I made sure to stay away from the splice junctions, have avg. length ~22 nt, have the GC % range from 40-60%, and have them end in C's or G's to provide a stable 3' end for primming. Other than that I have not used any other criteria.
Keeping the above in mind I designed the primers as such:

----------------------------------------------------------------------

***(PRIMER A)****
Common forward primer for all 6 isoforms:

This primer is within exon # 28 which is identical/ common to all isoforms

The entire exon is 139 nt in length

Primer length of 24nt -

5'- CAG ATG GTA TGA ATC TGG GTG AGG - 3'

This avoids the first 29 nt from the 5' end of the exon (in an attempt to avoid being close to the splice junction)
and extends in forward direction towards exon # 30.

This particular primer sequence is not found within any of the other exons

GC % = 50, Tm = 60C

------------------------------------------------------------

***(Primer # 1)***

This is the reverse primer within exon# 32 of RE/RG

Lenght is 21 nt

5' -CTC AAC GAA GTC TGC TTA CGC- 3'

This primer starts 101nt from the 5' end of exon #32, and extends in the reverse direction towards exon # 28.

GC % = 52, Tm = 58C

------------------------------------------------------------------

**(Primer # 2)**

This is the reverse primer within exon# 30 of RE/RG

Lenght is 23 nt

5' -CTA TAT GGG ACC GGA ATC AAG CG- 3'

This primer starts 46 nt from the 5' end of exon #30, and extends in the reverse direction towards exon # 28.

GC % = 52; Tm = 60C

-------------------------------------------------------------------

**(Primer #3)**

This is the reverse primer within exon # 30 of RH

Length is 22 nt

5' -CGT TTG AGG GCA TTG ATG AGC G- 3'

This primer starts 328 nt from the 5' end of the exon #30, and extends in the reverse direction towards exon # 28.

GC % = 55; Tm = 60C

-------------------------------------------------------------

**(Primer # 4)**

This is the reverse primer within exon # 30 of RF

length is 25nt

5'- CGG TAA TAC CAC ACA TTA ATC AGA G - 3'

This primer starts 928nt from the 5' end of the exon, and extends in the reverse direction towards exon # 28.

GC % = 40; Tm = 57C

---------------------------------------------------------

***(Primer # 5)***

This is the reverse primer within exon # 30 of RD

length 24 nt

5'- GTT CGA CCT TGC GAG TAT AAT TGC - 3'

This primer starts 116nt from the 5' end of the exon, and extends in the reverse direction towards exon # 28.

GC % = 46; Tm = 59C

----------------------------------------------------------------------

Logic behind primer selection:

If I detect PCR product from the following, then --

1) Primer A + primer # 5 = isoform RD.

2) A + # 4 = isoform RF.

3) A + # 3 = isoform RH.

Isoform RF will automatically give prdt for primer # 3 as well. So if RF is present, whether RH is also truly present can be confirmed with primer # 1 or # 2

4) A + #1 is positive, but A + #2 is negative, = isoform RC

I spoke to a couple of people, and considering the fact that qPCR is very expensive, I think I would prefer using regular PCR if it can work

Thanks once again for all your invaluable help

S.A.D.

R Bishop wrote:

Now that Ive seen your gene, I can better help you.

I would design a common 3' primer to all 6 splice forms of the gene in the middle exon indicated in the diagram above.

Then you need a unique 5' primer for EACH splice variant otherwise you cannot tell the variants apart by PCR.

You can find each splice variant exon using flybase.
First go to this link

http://flybase.org/reports/FBgn0259214.html

then in the pulldown boxes on the right side select CDS and click get FastA.

This will pull up this page
http://flybase.org/cgi-bin/getseq.html?source=dmel&id=FBgn0259214&chr=4&dump=PrecompiledFasta&targetset=CDS

From here you see all the mRNAs for the 6 variants. You can now search each variant at the UCSC genome browser.

Here
http://genome.ucsc.edu/cgi-bin/hgBlat

Then paste the coding sequence in the box, select D. melanogaster and hit submit. Your gene is the top one select BROWER.

Now you see the splice variants again. click on the first protein coding variant. you'll see this screen.
http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr4:349833-376092&db=dm3&ss=../trash/hgSs/hgSs_genome_306b_2b89e0.pslx+../trash/hgSs/hgSs_genome_306b_2b89e0.fa&hgsid=117605097

Click on the first coding variant. Brings you to this screen

Now select "Genomic Sequence (chr4:349,442-379,282)"
click submit and you will see the exons in caps and the introns in small letters. you should now be able to pick the exons, splice junctions, and make your primers.

This exon is common to all isoforms. Check me on this before designing though.

GTGGACGAATCTTCTCTGACTGGAGAGTCTGATCACGTCAAAAAGGGGCCAGATG
TTGATCCCATGGTTTTATCCGGCACGCATGTTATGGAAGGAAGCGGCAAA
ATGGTTGTTACAGCCGTAGGGGTAAACTCACAAGCTGGTATAATTTTTAC
GCTCCTTGGTGCGGCAGTTGACGAACAAGAAGCAGAAATTAAGAAGATGA
AAAAGG

Get back to me when you get the primers designed. Im off to ASCB until Thursday though. sorry.

Rb