q RTPCR

6 posts / 0 new
Last post
silver
silver's picture
q RTPCR

 I am new to q PCR.  I want to design primers for a gene in Soybean. How can I desig intron spanning primers for this?

Ivan Delgado
Ivan Delgado's picture
The first thing you do is

The first thing you do is obtained the genomic sequence of your gene, which contains introns and exons. Then you identify where the introns are and cut them off. An easy way to do is is to compare the cDNA to the genomic sequence. Once you've done this, all you need to do is design the primers in such a way that one primer is upstream of the intron junction and the other primer is on the other side of the intron junction. 

Good luck

silver
silver's picture
 Thnks Ivan. 

 Thnks Ivan. 
Can you pls help me a little with this further more. I am using http://www.phytozome.net/genePage.php?crown&method=2293&search=1&searchText=clusterid%3A27756872&detail=1, to obtain sequences.
How can I compare Genomic vs transcript and et rid of introns.?

Guest (not verified)
Guest's picture
Call or email to IDT customer

Call or email to IDT customer service: http://www.idtdna.com/search/websitesearch.aspx
They are always ready to help you.

They also offer online user guide (http://tinyurl.com/3gx8d63) and software (http://www.idtdna.com/scitools/Applications/RealTimePCR/) for design of qPCR assays.

All the Best.

Ivan Delgado
Ivan Delgado's picture
There are software programs

There are software programs that can do that. Alternatively you can simply copy and paste the sequences in Word, or another word processing software, and align the sequences by eye. The website you referenced already shows you where the introns are located, so all you need to do is compare the genomic sequence: 

TTGTAGTTGAGTAGACAGAGAGGAGTGTTCAGGGCAGTTTACAAAGCCAAATTTTGTTCCTTAGTTGTTTCCTTGTTCTCTGTAACTGATGGCTGATTATTCAGCAGGAACTGAATCCCAGGAGGTGGTCGTAAATGTAACCAAGAACACCTCCGAAACAATCCAACGCTCAGACTCCCTTGTCTCTGTTCCTTTCTTGCAGAAGGTGTCTCCTAATCTTCCTTTTGTACCCAAACCCAAAAAACCATTAAAGTGCTCTAATTACAATTTACAATTTATTAGATATAATGGTTTATTATCTCTACTAGAAGTCTAGAATTTCTTTTTGTGTATATAGTTTTTTTTTGAATTAATCTATTTATCGTATCATATTACTAAGAGTGGTTGAGCAGGAAATTAAATATGATATTTCCTTTAGTGTGCTGTAGAGTTCTAGTAGCGGGTGCAGTGTCAATCTTGTTGGGATTTCGTTTGCTTTTTTGAGGCTCCTGCATGCCACTTCTTTGGATAAAAAAATGTGACTTTAACAGGATGCGTTGGTTATTGTACATGTACTTGTTTTGGATTCTAATGGATAAAAAGAATTCTGTTGATCACATTGAACTAGAAAAATTGAGAGTGGAATTGAAATGATAATATCATGGTTTTGTTTGTTGATGGATGCAGTTGGTAGCTGAGGCGGTGGGAACATATTTCCTGATATTTGCAGGGTGTGCTTCATTGGTGGTGAACGAGAACTACTACAACATGATAACATTTCCTGGGATAGCAATTGTTTGGGGTCTGGTTCTGACGGTGTTGGTTTACACTGTCGGTCACATCTCTGGTGGCCATTTCAATCCTGCTGTCACCATTGCTTTTGCCTCCACCAGAAGATTCCCCTTGATCCAGGTAAGTATGCTCATTTGGAATTTATGTAGCTCATAACCTTTTTCTTAACTTAGTTGATATAAATAGGCAAATATGCTCATTTGGAAAATTGTGTCTTTTTCCTTCCTAATTGTTGTCTCTAGCTTGCCCCAAAAGAAATTATGAGATACCATACCATATACCAAAAATAGAAATTATGAAAGTAACTCCTGACTTATTTCTCTGTCCTTCTCACACTAATTGATCATTGCCAAAAAAAGTTGCCTCTTTGCACATGTATAGGCAACTAGGATATTTCATATTCACAGAAAAAACAATTCTTCTGTGAAGTTGTTTTAAAATTATGGGTTCTGGCATGAGATGCAAATTGCAATTAATTACCGTTGTTAAATATAGGTACCAGCTTATGTAGTAGCTCAACTCCTAGGAAGCATACTTGCAAGTGGAACTCTGAGACTATTATTTATGGGGAATCATGACCAGTTTTCAGGAACAGTCCCAAATGGGACTAACCTGCAGGCTTTTGTGTTTGAATTCATAATGACCTTTTTCCTCATGTTCGTCATATGCGGGGTTGCCACCGATAACAGAGCGGTAACGTCTCTCACATTTCTCCCTCTGCTTAAATTGGTACTATGTTACTAGTACTTTCTTGTGAGATTTAGTGACCTTGATAAAGTTTATTAAACCAGAGATAATATTAATTAATTCATAGTTTATTTATTAACTAAATTGCATCAATCTCAATGAATAATGTTATATGTGCACCTTTTTGTTATAAATAATTACACTCATTTGACACACTCAAAGGGATTTCAGACTTGAATCCTGGTGAAGAAATAATCTTTGGAGATGGGATGAACTGATGCAATCCTTTTGCATGATTACCTCTAAAAGAGAAAATAACAAGATCTAAATAAAACTCACTTGACGTATTTTATCTCTTTATCTTTTATTATTATATCATCACTTTTTATATTATGTTTAGTGAAAGAGATAATAAATACTCTTGATACTAATAATATAATTTATCTAGAAAAATGATCTCGTTTCTTTATTTTATTTTCTTTTGTTTATCTCCCTACGATGGGCATGGGTTGCACCAAATATTACCCTAATTAAATAAATTTATTTTTTAATCCAGAGATAATATTAATTCACAGTTTATTTATAATATTGAGAATTATAATTAAAAAATTGTAAATAAACAATTCAAACATAATATAATATTTAAATGTTGTTTAGTTCATACAATAAAATATTTTTTTACGGAAAATAAATATCTTAAAATAATGCTCTCTGGAGTGTTTTCATTTTTTTCTAAAGGTCTCAAACCAATTTCACTGGTTTTTTGAACAGTTTTTTGAACCGTTAATGTTTTGAGTCGTGTAAATTGAATACTTAATGGGACCTTTCATTTTATAGTAAAAAAAATGACCAATCGAACCCAATATTTGTAATAATGACAGGAAGAAATGGAGAGAGGCATGGCAACACTGAGGTTAATGGTTGACCTTTCATGATGATATTTTTGTAGCAGTCCATAAAAAATTTACTTTATTTTTACGCTATTTTTAATAGTAAAATAATATAAAATTTATAAATTGTTCTTACATCACTTCTTTTCTTCATAAGAATCGACAAAAATGCACAATCTAAGTCGGCTCAACTTTGGTGTAAAAAAAAAAAGTCGGCTCAACCTATATTTAGGTCTAAAAGGAAATTTAAGATGATTTTTTAAAATTACTTTAAATGCTATTTAAAATTATTATTATTTCCATTTTTATTTATAAGACTACTCAAATTAGAAATGGTATTTGTGCCTTCGAATGTAGTATCTCCATCTCCATTCTAAATTACTCCCAATGTTTAGCAAATTAGGCTTCACAAATTTTAAAAAAAAAATGGTACGGAATTTGTATCGTTTAGAATCGCTTGCAAGAATCCTAGAAGTTTACGTTACGAAGCGTATCTCATGAGAACTAATATTCTTCTTAAACTCCTTTATTTATTAACTTGAATTTAAAATTATGCAGGTTGGTGAGTTGGCTGGGATTGCAATTGGGTCGACATTACTGCTGAATGTGATTATTGGAGGGTAATACTAATTATTAACCAATCCAAATCCTAATTAAATGCAAAATATTAAAGAGTGCATAGGCTTTTACAACATTATATTGTTGAGTTGTGGGACATAAGAATGGTTATTGATATTTGACAGGCCAGTGACAGGAGCATCAATGAACCCAGCTAGAAGCCTAGGACCTGCTTTTGTACACGGTGAATACGAAGGAATATGGATATATTTGTTGGCACCTGTTGTGGGGGCCATAGCTGGAGCATGGGTATACAACATCGTTAGGTACACAGACAAGCCATTGAGTGAGATCACCAAGAGTGCTTCTTTCCTCAAAGGCCGTGCTGCCTCCAAATAATTTATATGAGCAAATGGAGACACTCAATAAATTCTTCCTTGTAATAGTAATTAGAAAAAAATAAATATGAATGAAAGAAATCACTCAAAGAAACTACGCTATGCTGTTTCATTTCCTTGTTTTATGAAAGGTCATGCACTTGAATATCATCTCCCTCTTTTTCCTCTCTATTTGGATTAAAAATAAATGATTTTTGACATTGTTGGTGGATCTTAAGCTTTGTGGACC

with the transcript:

TTGTAGTTGAGTAGACAGAGAGGAGTGTTCAGGGCAGTTTACAAAGCCAAATTTTGTTCCTTAGTTGTTTCCTTGTTCTCTGTAACTGATGGCTGATTATTCAGCAGGAACTGAATCCCAGGAGGTGGTCGTAAATGTAACCAAGAACACCTCCGAAACAATCCAACGCTCAGACTCCCTTGTCTCTGTTCCTTTCTTGCAGAAGTTGGTAGCTGAGGCGGTGGGAACATATTTCCTGATATTTGCAGGGTGTGCTTCATTGGTGGTGAACGAGAACTACTACAACATGATAACATTTCCTGGGATAGCAATTGTTTGGGGTCTGGTTCTGACGGTGTTGGTTTACACTGTCGGTCACATCTCTGGTGGCCATTTCAATCCTGCTGTCACCATTGCTTTTGCCTCCACCAGAAGATTCCCCTTGATCCAGGTACCAGCTTATGTAGTAGCTCAACTCCTAGGAAGCATACTTGCAAGTGGAACTCTGAGACTATTATTTATGGGGAATCATGACCAGTTTTCAGGAACAGTCCCAAATGGGACTAACCTGCAGGCTTTTGTGTTTGAATTCATAATGACCTTTTTCCTCATGTTCGTCATATGCGGGGTTGCCACCGATAACAGAGCGGTTGGTGAGTTGGCTGGGATTGCAATTGGGTCGACATTACTGCTGAATGTGATTATTGGAGGGCCAGTGACAGGAGCATCAATGAACCCAGCTAGAAGCCTAGGACCTGCTTTTGTACACGGTGAATACGAAGGAATATGGATATATTTGTTGGCACCTGTTGTGGGGGCCATAGCTGGAGCATGGGTATACAACATCGTTAGGTACACAGACAAGCCATTGAGTGAGATCACCAAGAGTGCTTCTTTCCTCAAAGGCCGTGCTGCCTCCAAATAATTTATATGAGCAAATGGAGACACTCAATAAATTCTTCCTTGTAATAGTAATTAGAAAAAAATAAATATGAATGAAAGAAATCACTCAAAGAAACTACGCTATGCTGTTTCATTTCCTTGTTTTATGAAAGGTCATGCACTTGAATATCATCTCCCTCTTTTTCCTCTCTATTTGGATTAAAAATAAATGATTTTTGACATTGTTGGTGGATCTTAAGCTTTGTGGACC

Calling or emailing IDT would also be a very good idea.

Cheers

silver
silver's picture
 THNK U so much..

 THNK U so much..