Long primer PCR NOT working

12 posts / 0 new
Last post
Liming
Liming's picture
Long primer PCR NOT working

Anybody ever did PCR with very long primers, like 50bp? The pair of the primers are very different. One is 24 bp. Another has 52 bp, with the overhang of 28bp. Tried several time but not successfully. Any expert knows how to make it work? Thanks in advance!

Jason King
Jason King's picture
When you say that the PCR

When you say that the PCR doesn't work, does this mean you get nothing on the gel, a smear, or the wrong sized band?

How many G/C and A/T do you have annealing in the first round of the PCR for each primer?

Knowing this I would consult an annealing table I have (because the 4 and 2 rule is too unreliable). It gives the temperature at which 50% of the primer binding sites will be bound so I'd drop the temperature about 1 degree below this.

Also you might think about using a slower than normal temperature ramp from the 95 degrees to the annealing temperature just calculated.

If you have a PCR machine with a gradient block then it's probably a good idea to run a number of samples (usually up to 12) with annealing temperature varying between Tm-5 degrees to Tm+15 degrees - then you'll see when you get the most efficient annealing.

Remember that in subsequent rounds of PCR, the longer oligo will be annealing before the shorter one since the template will be derived from an earlier PCR product that includes the long oligo's complementary sequence.

If you post the (1st round annealing) GC and AT content (eg. 18:12 respectively) for each primer I'll check it on my table and post what I get

PM

Liming
Liming's picture
Thank you so much, Parvoman!

Thank you so much, Parvoman! In the first cycle, the short primer(TCCAGCCTCTGCGCCAGACCTATC): GC 62%; the long primer(GCGCGGTCTCAGTATGCTATACGAACGGTA-CATTTATTATTTCCTTCCTCTT): GC 27%.

I got nothing on the gel except primer dimer. I do want to try it again this weekend on a gradient block with annealing temperatures you suggested. Thx a lot!

LM

Jason King
Jason King's picture
Liming wrote:Thank you so

Liming wrote:

Thank you so much, Parvoman! In the first cycle, the short primer(TCCAGCCTCTGCGCCAGACCTATC): GC 62%; the long primer(GCGCGGTCTCAGTATGCTATACGAACGGTA-CATTTATTATTTCCTTCCTCTT): GC 27%.

I got nothing on the gel except primer dimer. I do want to try it again this weekend on a gradient block with annealing temperatures you suggested. Thx a lot!

LM

Hi,

I've not had a chance to check the oligos in the lab yet but just by eye I would expect there to be problems with the long primer. As a rule, I try to design primers so that the 3' ends have 2 G/Cs. The 3' half of your long primer has a lot of nasty consecutive A/Ts whilst the 5' half (and especially the 5' end) looks like it will anneal very strongly.

Because the other primer is much shorter you will be forced to use an annealing temperature that is much lower than the optimal one for the long primer. You might find that the 5' portion of the long primer binds to additional target sequences, but this will depend on the complexity of the template DNA.

Of course, I don't know what exactly you are doing or what size the expected PCR product is but it might be interesting to do the first annealing at the optimal temp for the long primer and then from cycle 2 onwards, use the lower annealing temp. This way you may be able to enrich your template molecules for the one you are after (ie the one with the long oligo incorporated). It's the same idea as making first strand cDNA using an oligo dT primer to "enrich" for the <5% mRNA out of the pool of total RNA.

I've never done this but I don't see what harm it could do. It should be possible to program a gradient block to do this. ie. Cycle 1: Tm of about 70 degrees then cycle 2-35 over a range of 50-65 degrees then see which works best (if any).

I'll post again on Monday to let you know what my "cheat sheet" annealing temp table comes up with. Have a good weekend.

PM

Jason King
Jason King's picture
Hi again,

Hi again,

I just read your initial posting again and realised that the 28bp overhang is the GC rich bit and the annealing bit has all those TAs! So there's no point in doing an initial cycle at a higher temp. I'll post again with something (hopefully) more helpful.

Jason King
Jason King's picture
Just checked the table and it

Just checked the table and it gave:

short primer: Tm=65.3

Long primer (just the annealing bit): Tm=48.3

So for the PCR I would normally knock 2 degrees off of each and select the lowers temperature. But, for the long primer you will need to allow for a) the fact that the annealing bit has a very low GC content, b) there is an 11 nucloetide stretch of AT which lowers stability and c) there's a large non-annealing 28nuc stretch getting in the way too.

Basically, if you can redesign the 3'portion of the long primer this would help. If you can't then I would set up the PCR with just the long primer in it. Set a Tm for the first cycle of between 35 and 50 degrees in a gradient block then add in the shorter primer to each tube just after the first extention is finished. And of course, keep your fingers crossed too.

PM

Liming
Liming's picture
Thanks a lot, Parvoman! I did

Thanks a lot, Parvoman! I did the pcr with gradient annealing temperatures(50-60 degree), even tried with another set of pcr with concentations of magnesium at 54 degree. What I got is some smear streaks on the gel, seeming to be very unspecific amplification. Very weird!

Now I incline to believe the overhang of the primer may be a big problem. I'll try the addition of primers one by one for the last time. If it still refused to work, I will go to new primers. Thank you so much!

LM

Jason King
Jason King's picture
OK, good luck. Just to recap

OK, good luck. Just to recap in case my last post was unclear:

Gradient Cycler:

Cycle 1: Annealing at between 35 and 50 with no short primer present

Add the short primer

Cycle 2-35: Annealing temp at 62 degrees

harbin
harbin's picture
Liming wrote:Thanks a lot,

Liming wrote:

Thanks a lot, Parvoman! I did the pcr with gradient annealing temperatures(50-60 degree), even tried with another set of pcr with concentations of magnesium at 54 degree. What I got is some smear streaks on the gel, seeming to be very unspecific amplification. Very weird!

Now I incline to believe the overhang of the primer may be a big problem. I'll try the addition of primers one by one for the last time. If it still refused to work, I will go to new primers. Thank you so much!

LM

Have you got any luck in your PCR? I'd like to know as I met the same problem!

12345
12345's picture
Try using modified bases such

Try using modified bases such as 2,6 diaminopurine, 2-Methyl dT on your shorter Oligos. The modifications will increase the Tm and thus bring it closer to the tm of the longer oligo. The tm of the longer oligo is closer to 72 C.

maharana7
maharana7's picture
Hi,

Hi,
 
I have used 80bp primer for PCR with 20bp as primer 60bp as homology arm, these primer has worked before with my normal PCR. And now these primer are not working at any condition.

Could anyone has any idea about my problem?

thank you

Ethan Sarnoski
Ethan Sarnoski's picture
 I recently came across this

 I recently came across this posting while trying to troubleshoot a PCR I was doing with 20 bp annealing regions and 50 bp 5' overhangs. Using a gradient with or without GC buffer, I got a smear of bands just below the expected band size at best. However, I eventually solved this by performing 5 cycles at the annealing temperature matching the 20 bp annealing region, and 30 cycles with an annealing temperature matching the whole 70 bp primers. I am unsure how a constant temperature resulted in the smear, but I now get the band size i was looking for. Hope this helps others in the future.

For clarification, my cycling conditions were thus:
5 cycles:
98 C denaturation
55 C annealing
72 C extension

30 cycles:
98 C denaturation
72 C annealing/extension