How to find different gene promoter features?

14 posts / 0 new
Last post
crisspy
crisspy's picture
How to find different gene promoter features?

Dear Friends
I need to find some information about the promoter for my gene of interest. I'm working on human APLP2 gene (Accession Numbers:  NM_001642).
The information I need for this gene is:
1) How to locate promoter of this gene?
2) Is there any software available that can predict the type of elements present in the promoter of this gene? For example whether the promoter contains INF gamma response element etc...
3) What kind of proteins/transcription factors can bind to the promoter of this gene?
Your help in this regard will be highly appreciated as I don't know how to go about finding all the above mentioned information.
Thanks in advance...

Fraser Moss
Fraser Moss's picture
(Click the underlined

(Click the underlined hyperlinks in this post to reach the info you want)
As part of Cold Spring Harbor Laboratory's Mammalian Promoter Database you can Extract the promoter sequences for the promoter of your human gene of interest.
I entered your gene accession number, NM_001642 in the promoter sequence extractor and found the following

Prom ID
Type
Chr.
Strand
1st exon start
1st exon end
1st acceptor site
distance to gene
Gene ID
Query ID
Species

EP74213
EPD
chr11
+
129444999
129445186
129484533
-1
hchr11_00686
NM_001642
Human

 

>NM_001642-Human-1 EP74213 chr11 + 129444299 129445299 hchr11_00686
ctgctgggaaggaagggtcggcaagaggcctaaagaccggaggccaagggtgcggagcgcggccggactcagaggcgagg
acccggcggagaggcctgggcggagcagggcgggagaggcgcgccctgagtagggctcgggggaggacgatggctgcctc
ctgcggtcctccccctgcctcgggggacggcccttggcagaccgtcccggactcctaattcatcctgtttttaataaaac
catttccagaatcaaaaagagggcggtacccaaaggagtctgaagaatgcccagcaggggcaggggagcggggcgtgccc
gtatcgggaggctgaaggctgacggaccagcgcagcagggacagataaccgcgccggggggcggaggccagagccagccc
cgcgcccacagggttgcggccccagacccgccgcgcgcacgcccccgcgcctggcggccacagggtccggagcgggggcg
gggccatccgcggccgggggcggggccgggcggggggcgcgcggttggaccgggcgggaggagcaggctcttccatctcc
tgattgggtctggaccgcaagggggcggggtcttgaggggttctgcgggccggcattgggagccgcagaaggagggcgtg
gtaatatgaagtcagttccggttggtgtaaaacccccggggcggcggcgaactggctttaGATGCTTCTGGGTCGCGGTG
TGCTAAGCGAGGAGTCCGAGTGTGTGAGCTTGAGAGCCGCGCGCTAGAGCGACCCGGCGAGGGATGGCGGCCACCGGGAC
CGCGGCCGCCGCAGCCACGGGCAGGCTCCTGCTTCTGCTGCTGGTGGGGCTCACGGCGCCTGCCTTGGCGCTGGCCGGCT
ACATCGAGGTGGGGACCGGGCGAACGCCGGAGAGTCGTCTCCTTCGCCCGCCGGAGGAGCGCGGACTGCGGGCGGGCAGC
GGGGTCCGCGGCAGGGCGGGCCGGCGGTGCGGCGCCGGGG

I used the default flank regions for 5'- and 3'- flank regions of 700 bps and 300 bp.  You can change these in you own search if you want.
You can now enter that FASTA formatted promoter file above into TRED - the Transcriptional Regulatory Element Database

You can do many things there and you should spend some time reading about the tools there yourself and experimenting with them.  One that you will find useful is the Motif Analysis
You can also search for homologous promoters, find palindromes etc etc
Please post back and let us know if this information helped you out.

Fraser Moss
Fraser Moss's picture
here are some other sites

here are some other sites that may help you
Promoter and Transcription Factors Databases
 
 

  •  
  • EPD - Eukaryotic Promoter Database at EMBL, Heidelberg
  • dbTSS - database of Transcriptions Start Sites
  • Jaspar - The high-quality transcription factor binding profile database
  • PLACE - Database of Plant Cis-acting Regulatory DNA Elements
  • PlantCare - a Plant Promoters database
  • PlantPromDB - A Database of Plant Promoter Sequences
  • SCPD - the Promoter Database of Saccharomyces cerevisiae
  • TFD - the IFTI-MIRAGE website
  • TransFac - Gene Regulation
  • TRED - Transcriptional Regulatory Element Database
  • TRRD - Transcription Regulatory Regions Database
  • Dragon TF Integrator
  • cisRED database holds conserved sequence motifs identified by genome scale motif discovery
  • http://cmgm.stanford.edu/help/manual/databases/epd.html
    http://www.genomatix.de/online_help/help_gpd/gpd_help.html
    http://www.epd.isb-sib.ch/
  • Promoter Search Tools
     

  •  
  • Audic - Self-identification of coding regions in microbial genomes
  • CONPRO - CONsensus PROmoter
    predictor
    -->
  • CorePromoter - Human Core-Promoter Prediction Program
  • Dragon Promoter Finder
  • Eponine - Transcription Start Site finder
  • Gene Regulation Tools - (transfac search, Match, Patsearch,etc....)
  • McPromoter - The Markov Chain Promoter Prediction Server
  • NNPP - Prokaryotic promoter prediction at BCM

  • Pol3Scan - searches the eukaryotic
    polymerase III intragenic control regions A box and B box, Italy
    -->
  • PromFD - (download)

  • PromFind
    -->
  • PromFind - (download)
  • Promoter2.0 - Prediction server at CBS
  • PromoterInspector - Prediction of promoter regions in mammalian genomic sequences
  • Promoter Prediction - (Eukaryote + Prokaryote) by Neural Network at LBNL
  • PromoterScan 2 - predicts putative eukaryotic Pol II promoter sequences
  • Regulatory Sequence Analysis Tools
  • rVISTA - for comparative sequence-based discovery of functional transcription factor binding sites
  • Self-identification - of coding regions in microbial genomes
  • SignalScan
  • SoftBerry tools - for gene regulation and promoter search
  • Zhang Lab Tools - Promoter tools and databases for Human, Drosophila, C. Elegans, Arabidopsis, Yeast
  • Zlab - many tools for gene regulation
  • Transcription Start Site Prediction
     

  •  
  • DBTSS - Database of Transcriptional Start Sites
  • Dragon Gene Start Finder
  • Eponine - Transcription Start Site finder
  • FIE2 - Five-end Infromation Extraction v.2
  • FirstEF - first-exon and promoter prediction program for human DNA
  • PromoSer - Human, Mouse and Rat promoter extraction service
  • Transcription Binding Tools
     

  •  
  • ALIBABA - predicts transcription factor binding sites by constructing matrices on the fly from TRANSFAC
  • Cister - Cis-element Cluster Finder
  • COMPEL - database on composite regulatory elements affecting gene transcription in eukaryotes
  • F-Match, Patch (PatSearch), Match....(Transfac 6.0) - programs links
  • MatInspector - find binding sites for transcription factors, at the GenomatixSuite, Germany
  • PLACE - a database of Plant Cis-acting Regulatory DNA Elements
  • RSA-tools - Regulatory Sequence Analysis tools - Search a pattern (string description) within all upstream or downstream regions of a genome


  • Search for Transcription Factor Binding Site Clusters
    - in the Human Genome
    -->


  • TRANSFAC
    - pattern search with TRANSFAC sites
    -->
  • TESS - Predicting Transcription factors binding sites at CBIL, USA
  • TFSEARCH - searching Transcription Factor Binding Sites, Japan
  • Tfsitescan - at IFTI
  • TRANSFAC - a database on eukaryotic cis-acting regulatory DNA elements and trans-acting factors
  • shareef
    shareef's picture
    Wow thanks, we have also been

    Wow thanks, we have also been looking into databases for promoter sequences, this also helps us out.

    Kmay
    Kmay's picture
    Dear Crisspy,

    Dear Crisspy,
    APLP2 has 9 different promoters for 17 alternative transcripts. NM_001642 is only the longest with the most 5´ located Promoter.
    Further down I paste the information as you get it when entering the gene into the WYAWKAGNDA input box on top of the screen of www.genomatix.de
    Which TFs physically can bind is an easy task with MatInspector, however, which of those are biologically relevant is the hard part.
    Some background on TFBS analysis you can find in the poerpoint presentation " MatInspector: Too Many Matches" from
    www.genomatix.de/download/download4.html 
    direct download link:
    www.genomatix.de/download/tutorial/TooManyMatches/TooManyMatches.pps
    All physical TFBS in the proximal promoter for your transcript (180 matches, you´ll find at the end of this posting.
    When it comes to promoter analysis, the site of choice is www.genomatix.de.
    Results for: APLP2 ; Organism: human;
    Gene Name: amyloid beta (A4) precursor-like protein 2; Gene Symbol: APLP2; Gene ID: 334;

    Synonyms:

    APLP2 | APPH | APPL2 | CDEBP more

    Protein Names:

    amyloid beta (A4) precursor-like protein 2 | amyloid precursor protein homolog HSD-2 more

    Functional Information:

    n/a more

    DNA Sequence Based
    Quality checked, complete and in all detail from the Genomatix extended genome annotation and analysis database ElDorado

    17

    All alternative transcripts for APLP2 available in the Genomatix genome annotation
    Alternative transcripts (-->detailed information)

     

    10

    Number of species that contain orthologous genes, based on a Genomatix proprietary algorithm for building homology groups
    Organisms in homology group (-->detailed information)

     

    9

    All distinct promoter regions for the (alternative) transcripts of APLP2 available in the Genomatix genome annotation
    Promoter regions (-->detailed information)

     

    8

    Sets of orthologous promoters (-->detailed information)

     

    46

    Transcriptional start regions with experimental evidence like CAGE tags or full-length cDNAs
    Transcriptional start regions (experimental evidence) (-->detailed information)

     

    57

    Tissues where APLP2 is expressed, proven experimentally
    Experimentally verified tissues showing expression (-->detailed information)

     

    78

    Combinations of transcription factor binding sites experimentally proven to work synergistically or antagonistically to regulate gene expression
    Transcription factor modules found in promoters (-->detailed information)

     

    135

    Unique single probes in 12 Affymetrix probe sets (-->detailed information)

     

    19

    Single Nucleotide Polymorphisms that were found to delete/add a transcription factor binding site within the gene's promoter(s)
    SNPs affecting transcription factor binding sites (-->detailed information)

     

    no

    microRNAs within this gene locus
    microRNAs (-->detailed information)

     

    14

    SNPs affecting protein sequence (-->detailed information)

     

     

    Biological Knowledge Mining
    Biological entity relations, pathway associations, gene networks: from the Genomatix knowledge databases BiblioSphere and LitInspector

    132

     (

    Abstracts addressing APLP2

    (-->detailed information)

     

    2

    Associations of signal transduction pathways with APLP2, based on Genomatix knowledge mining on PubMed

    Signal transduction pathways

    (-->detailed information)

     

    442

    Sentences in PubMed abstracts containing this gene name (APLP2) or one of its synonyms, based on a Genomatix proprietary algorithm for gene recognition

    Sentences addressing APLP2

    (-->detailed information)

     

    9

    Manually curated gene effects and interactions, derived from NetPro database
    NetPro expert curated gene effects and interactions (-->detailed information)

     

    98

    Genes associated with APLP2 (-->detailed information)

     

    1

    Gene effects and interactions manually curated by Genomatix experts
    Genomatix expert curated gene effect or interaction (-->detailed information)

     

    258

    References for associations between APLP2 and other genes as found in PubMed abstracts, based on a Genomatix proprietary algorithm for gene recognition
    References for associations between APLP2 and other genes (-->detailed information)

     

    67

    Tissues associated with APLP2, based on UniGene
    Tissue Associations (-->detailed information)

     

    7

    Transcription factors found to be associated with APLP2 as found in PubMed abstracts, based on a Genomatix proprietary algorithm for gene recognition
    Transcription factors associated with APLP2 (-->detailed information)

     

    7

    GeneOntology terms associated with APLP2 (cellular component / molecular function / biological process)
    Associated GO-Terms (-->detailed information)

     

    3

    Transcription factors found in literature and additionally having a binding site in APLP2's promoter(s)
    Transcription factor associations, additionally supported by promoter binding site (-->detailed information)

     

    335

    MeSH terms associated with APLP2 (chemicals and drugs / anatomy / disease / biological sciences / analytical, diagnostic and therapeutic techniques and equipment)
    Associated MeSH Terms (-->detailed information)

     

    no

    Interactions between APLP2 and transcription factors, manually curated by Genomatix experts
    Genomatix expert curated gene - TF interactions (-->detailed information)

     

     

     
     
     Here the MatInspector output ( the graphics I cannot paste here):

     

    Search Results ( 180 matches)

    MatInspector Release professional 7.7.3.1, September 2008
    Wed Feb 4 13:26:32 2009

    Solution parameters:

    Sequence file:
    seq.seq

    Family matches:
    yes

    MatInspector library:
    Matrix Family Library Version 8.0 (November 2008)

    Selected groups
    (core/matrix sim)

    • Vertebrates (0.75/Optimized)

    Inspecting sequence GXP_208704 [GXP_208704] (1 - 733):
    [GXL_173989]
     

      
    Check transcription factor <-> matrix family assignment
    Opt.
    Position
    Str.
    Core sim.
    Matrix sim.
    Sequence
    (red: ci-value > 60
    capitals: core sequence)

    Family
    Matrix
    from - to

     
    V$CTCF
    V$CTCF.03
    0.76
    8 - 34
    (-)
    0.787
    0.775
    gggggaggaccgcaggAGGCagccatc

     
    V$PTF1
    V$PTF1.01
    0.76
    15 - 35
    (+)
    1.000
    0.769
    gcctCCTGcggtcctccccct

     
    V$EGRF
    V$CKROX.01
    0.88
    20 - 36
    (-)
    1.000
    0.899
    caggGGGAggaccgcag

     
    V$ZBPF
    V$ZBP89.01
    0.93
    20 - 42
    (+)
    1.000
    0.956
    ctgcggtcctCCCCctgcctcgg

     
    V$CTCF
    V$CTCF.01
    0.80
    21 - 47
    (-)
    1.000
    0.844
    gtcccccgaggcagGGGGaggaccgca

     
    V$KLFS
    V$KLF6.01
    0.92
    22 - 40
    (-)
    1.000
    0.951
    gaggcaGGGGgaggaccgc

     
    V$ZBPF
    V$ZNF219.01
    0.91
    23 - 45
    (+)
    1.000
    0.927
    cggtcctCCCCctgcctcggggg

     
    V$MYOD
    V$MYOD.01
    0.88
    26 - 42
    (-)
    1.000
    0.913
    ccgaGGCAgggggagga

     
    V$NOLF
    V$OLF1.02
    0.88
    30 - 52
    (-)
    1.000
    0.898
    gggccgTCCCccgaggcaggggg

     
    V$AP2F
    V$AP2.02
    0.92
    33 - 47
    (+)
    1.000
    0.943
    cctGCCTcgggggac

     
    V$NFKB
    V$NFKAPPAB.01
    0.89
    41 - 53
    (+)
    1.000
    0.892
    ggGGGAcggccct

     
    V$SF1F
    V$FTF.01
    0.94
    47 - 59
    (-)
    1.000
    0.940
    ctgcCAAGggccg

     
    V$BRNF
    V$TST1.01
    0.90
    65 - 83
    (-)
    1.000
    0.902
    gatgaATTAggagtccggg

     
    V$CART
    V$ALX4.01
    0.82
    65 - 85
    (-)
    1.000
    0.828
    aggatgAATTaggagtccggg

     
    V$HBOX
    V$EN2.01
    0.86
    68 - 86
    (-)
    1.000
    0.860
    caggatgAATTaggagtcc

     
    V$HOMF
    V$MSX2.01
    0.95
    68 - 86
    (+)
    1.000
    0.989
    ggactcCTAAttcatcctg

     
    V$BRNF
    V$BRN2.04
    0.82
    69 - 87
    (-)
    0.756
    0.820
    acaggatGAATtaggagtc

     
    V$HBOX
    V$GSH2.01
    0.95
    69 - 87
    (+)
    1.000
    0.970
    gactccTAATtcatcctgt

     
    V$HOXC
    V$PBX_HOXA9.01
    0.79
    69 - 85
    (-)
    0.750
    0.799
    aggaTGAAttaggagtc

     
    V$CART
    V$PHOX2.01
    0.87
    70 - 90
    (+)
    1.000
    0.876
    actccTAATtcatcctgtttt

     
    V$NKXH
    V$NKX25.02
    0.88
    70 - 88
    (+)
    1.000
    0.909
    actccTAATtcatcctgtt

     
    V$PAXH
    V$PAX4.02
    0.84
    71 - 85
    (+)
    1.000
    0.849
    ctcctAATTcatcct

     
    V$ETSF
    V$PDEF.01
    0.93
    72 - 92
    (-)
    1.000
    0.947
    taaaaacaGGATgaattagga

     
    V$HOMF
    V$HHEX.01
    0.95
    80 - 98
    (+)
    1.000
    0.972
    catcctgttttTAATaaaa

     
    V$CART
    V$PROP1.01
    0.84
    81 - 101
    (-)
    0.751
    0.842
    tggtttTATTaaaaacaggat

     
    V$LHXF
    V$LMX1B.02
    0.83
    82 - 104
    (+)
    0.754
    0.852
    tcctgtttttAATAaaaccattt

     
    V$LHXF
    V$LMX1A.01
    0.83
    83 - 105
    (-)
    0.765
    0.866
    gaaatggtttTATTaaaaacagg

     
    V$BRNF
    V$BRN3.02
    0.89
    84 - 102
    (+)
    1.000
    0.891
    ctgttttTAATaaaaccat

     
    V$ABDB
    V$HOXC13.01
    0.91
    85 - 101
    (+)
    1.000
    0.955
    tgtttttaaTAAAacca

     
    V$CART
    V$XVENT2.01
    0.82
    86 - 106
    (+)
    1.000
    0.830
    gttttTAATaaaaccatttcc

     
    V$CDXF
    V$CDX1.01
    0.94
    86 - 104
    (-)
    1.000
    0.957
    aaatggtTTTAttaaaaac

     
    V$HOXF
    V$HOXD3.01
    0.85
    86 - 104
    (+)
    0.766
    0.851
    gtttttAATAaaaccattt

     
    V$NKX6
    V$NKX61.01
    0.91
    86 - 100
    (+)
    1.000
    0.915
    gtttTTAAtaaaacc

     
    V$SATB
    V$SATB1.01
    0.94
    89 - 103
    (+)
    1.000
    0.941
    tttAATAaaaccatt

     
    V$YY1F
    V$YY1.02
    0.94
    94 - 112
    (+)
    1.000
    0.945
    taaaaCCATttccagaatc

     
    V$HAND
    V$TH1E47.01
    0.93
    96 - 116
    (+)
    1.000
    0.934
    aaaccatttCCAGaatcaaaa

     
    V$STAT
    V$STAT.01
    0.87
    96 - 114
    (-)
    0.769
    0.872
    ttgattctgGAAAtggttt

     
    V$SP1F
    V$SP2.01
    0.80
    116 - 130
    (+)
    0.772
    0.822
    aagagggcgGTACcc

     
    V$OAZF
    V$ROAZ.01
    0.73
    123 - 139
    (+)
    0.750
    0.734
    cgGTACccaaaggagtc

     
    V$BARB
    V$BARBIE.01
    0.88
    127 - 141
    (+)
    1.000
    0.885
    acccAAAGgagtctg

     
    V$TEAF
    V$TEAD.01
    0.90
    139 - 151
    (-)
    1.000
    0.902
    gggCATTcttcag

     
    V$CTCF
    V$CTCF.02
    0.69
    141 - 167
    (+)
    1.000
    0.719
    gaagaatgcccagcaggGGCAggggag

     
    V$KLFS
    V$KLF6.01
    0.92
    150 - 168
    (+)
    1.000
    0.941
    ccagcaGGGGcaggggagc

     
    V$PAX5
    V$PAX5.01
    0.79
    152 - 180
    (+)
    0.952
    0.841
    agcaggGGCAggggagcggggcgtgcccg

     
    V$KLFS
    V$KKLF.01
    0.91
    153 - 171
    (+)
    1.000
    0.936
    gcaggggcaGGGGagcggg

     
    V$SP1F
    V$SP1.01
    0.88
    153 - 167
    (+)
    1.000
    0.900
    gcagGGGCaggggag

     
    V$ZBPF
    V$ZF9.01
    0.87
    155 - 177
    (-)
    1.000
    0.888
    gcacgccCCGCtcccctgcccct

     
    V$PLAG
    V$PLAG1.01
    0.88
    156 - 176
    (+)
    0.958
    0.897
    GGGGcaggggagcggggcgtg

     
    V$P53F
    V$P53.02
    0.91
    158 - 180
    (+)
    0.803
    0.915
    ggcaggggagcggggCGTGcccg

     
    V$CHRE
    V$CHREBP_MLX.01
    0.82
    160 - 176
    (+)
    0.800
    0.821
    CAGGggagcggggcgtg

     
    V$KLFS
    V$KKLF.01
    0.91
    160 - 178
    (+)
    1.000
    0.929
    caggggagcGGGGcgtgcc

     
    V$SP1F
    V$SP1.02
    0.85
    161 - 175
    (+)
    0.750
    0.853
    agggGAGCggggcgt

     
    V$AHRR
    V$AHRARNT.03
    0.95
    162 - 186
    (+)
    1.000
    0.966
    ggggagcgggGCGTgcccgtatcgg

     
    V$SP1F
    V$TIEG.01
    0.83
    166 - 180
    (+)
    1.000
    0.859
    agcGGGGcgtgcccg

     
    V$HESF
    V$HES1.01
    0.92
    167 - 181
    (+)
    1.000
    0.920
    gcggggcGTGCccgt

     
    V$HICF
    V$HIC1.01
    0.93
    170 - 182
    (+)
    1.000
    0.934
    gggcgTGCCcgta

     
    V$SRFF
    V$SRF.03
    0.79
    173 - 191
    (-)
    0.786
    0.832
    gcctcccgatACGGgcacg

     
    V$SRFF
    V$SRF.01
    0.66
    174 - 192
    (+)
    0.757
    0.803
    gtgcccgTATCgggaggct

     
    V$GATA
    V$GATA1.06
    0.96
    176 - 188
    (-)
    1.000
    0.987
    tcccGATAcgggc

     
    V$CREB
    V$CREB.02
    0.89
    190 - 210
    (+)
    1.000
    0.924
    gctgaaggcTGACggaccagc

     
    V$CREB
    V$TAXCREB.01
    0.81
    193 - 213
    (+)
    1.000
    0.866
    gaaggcTGACggaccagcgca

     
    V$BNCF
    V$BNC.01
    0.85
    214 - 232
    (-)
    1.000
    0.918
    cgcggttatcTGTCcctgc

     
    V$GATA
    V$GATA1.04
    0.91
    219 - 231
    (+)
    1.000
    0.974
    gacaGATAaccgc

     
    V$OVOL
    V$OVOL1.01
    0.80
    220 - 234
    (-)
    1.000
    0.839
    ggcgcgGTTAtctgt

     
    V$CDEF
    V$CDE.01
    0.87
    224 - 236
    (-)
    1.000
    0.921
    ccggCGCGgttat

     
    V$ZBPF
    V$ZBP89.01
    0.93
    228 - 250
    (-)
    1.000
    0.958
    ctggcctccgCCCCccggcgcgg

     
    V$AP2F
    V$AP2.01
    0.90
    229 - 243
    (+)
    0.881
    0.905
    cgcGCCGgggggcgg

     
    V$RXRF
    V$VDR_RXR.01
    0.85
    229 - 253
    (+)
    1.000
    0.868
    cgcgccggggggcgGAGGccagagc

     
    V$EGRF
    V$EGR1.02
    0.88
    230 - 246
    (+)
    1.000
    0.906
    gcgccgggGGGCggagg

     
    V$GLIF
    V$GLIS3.01
    0.88
    230 - 244
    (-)
    1.000
    0.881
    tccgCCCCccggcgc

     
    V$SP1F
    V$SP1.02
    0.85
    234 - 248
    (+)
    1.000
    0.934
    cgggGGGCggaggcc

     
    V$CP2F
    V$CP2.01
    0.90
    240 - 258
    (-)
    1.000
    0.945
    ggCTGGctctggcctccgc

     
    V$ZBPF
    V$ZF9.01
    0.87
    252 - 274
    (+)
    1.000
    0.893
    gccagccCCGCgcccacagggtt

     
    V$EBOX
    V$MYCMAX.03
    0.91
    254 - 266
    (+)
    1.000
    0.919
    cagcccCGCGccc

     
    V$HESF
    V$HES1.01
    0.92
    254 - 268
    (+)
    0.944
    0.929
    cagccccGCGCccac

     
    V$SP1F
    V$SP1.02
    0.85
    254 - 268
    (-)
    0.750
    0.861
    gtggGCGCggggctg

     
    V$ZF5F
    V$ZF5.01
    0.95
    258 - 268
    (-)
    1.000
    0.989
    gtggGCGCggg

     
    V$KLFS
    V$EKLF.01
    0.89
    260 - 278
    (+)
    1.000
    0.955
    cgcgcccacaGGGTtgcgg

     
    V$RREB
    V$RREB1.01
    0.80
    279 - 293
    (+)
    1.000
    0.847
    cCCCAgacccgccgc

     
    V$SP1F
    V$SP2.01
    0.80
    282 - 296
    (-)
    0.772
    0.812
    cgcgcggcgGGTCtg

     
    V$SPZ1
    V$SPZ1.01
    0.94
    282 - 292
    (-)
    0.865
    0.948
    cGGCGggtctg

     
    V$AHRR
    V$AHRARNT.03
    0.95
    287 - 311
    (-)
    1.000
    0.979
    aggcgcggggGCGTgcgcgcggcgg

     
    V$EBOX
    V$MYCMAX.03
    0.91
    287 - 299
    (+)
    1.000
    0.931
    ccgccgCGCGcac

     
    V$HESF
    V$HES1.01
    0.92
    287 - 301
    (+)
    0.944
    0.981
    ccgccgcGCGCacgc

     
    V$NRF1
    V$NRF1.01
    0.78
    288 - 304
    (-)
    0.750
    0.801
    gggGCGTgcgcgcggcg

     
    V$EGRF
    V$EGR3.01
    0.77
    289 - 305
    (-)
    1.000
    0.818
    ggggGCGTgcgcgcggc

     
    V$NRF1
    V$NRF1.01
    0.78
    289 - 305
    (+)
    1.000
    0.847
    gccGCGCgcacgccccc

     
    V$ZF5F
    V$ZF5.01
    0.95
    289 - 299
    (-)
    1.000
    0.997
    gtgcGCGCggc

     
    V$NRF1
    V$NRF1.01
    0.78
    290 - 306
    (-)
    0.750
    0.797
    cggGGGCgtgcgcgcgg

     
    V$NRF1
    V$NRF1.01
    0.78
    291 - 307
    (+)
    1.000
    0.869
    cgcGCGCacgcccccgc

     
    V$ZF5F
    V$ZF5.01
    0.95
    291 - 301
    (-)
    1.000
    0.965
    gcgtGCGCgcg

     
    V$HESF
    V$HES1.01
    0.92
    292 - 306
    (-)
    1.000
    0.928
    cgggggcGTGCgcgc

     
    V$SP1F
    V$TIEG.01
    0.83
    293 - 307
    (-)
    1.000
    0.859
    gcgGGGGcgtgcgcg

     
    V$ZBPF
    V$ZNF219.01
    0.91
    294 - 316
    (+)
    1.000
    0.959
    gcgcacgCCCCcgcgcctggcgg

     
    V$EGRF
    V$WT1.01
    0.92
    295 - 311
    (-)
    0.953
    0.980
    aggcgCGGGggcgtgcg

     
    V$KLFS
    V$KKLF.01
    0.91
    295 - 313
    (-)
    1.000
    0.943
    ccaggcgcgGGGGcgtgcg

     
    V$NRF1
    V$NRF1.01
    0.78
    297 - 313
    (+)
    0.750
    0.823
    cacGCCCccgcgcctgg

     
    V$ZBPF
    V$ZF9.01
    0.87
    297 - 319
    (+)
    1.000
    0.887
    cacgcccCCGCgcctggcggcca

     
    V$EBOX
    V$MYCMAX.03
    0.91
    304 - 316
    (-)
    0.789
    0.917
    ccgccaGGCGcgg

     
    V$ZBPF
    V$ZF9.01
    0.87
    319 - 341
    (-)
    1.000
    0.872
    cccgcccCCGCtccggaccctgt

     
    V$ZBPF
    V$ZNF219.01
    0.91
    322 - 344
    (-)
    1.000
    0.953
    ggccccgCCCCcgctccggaccc

     
    V$KLFS
    V$KKLF.01
    0.91
    325 - 343
    (+)
    1.000
    0.942
    tccggagcgGGGGcggggc

     
    V$ZBPF
    V$ZF9.01
    0.87
    325 - 347
    (-)
    1.000
    0.984
    gatggccCCGCccccgctccgga

     
    V$EGRF
    V$EGR1.02
    0.88
    327 - 343
    (+)
    1.000
    0.970
    cggagcggGGGCggggc

     
    V$KLFS
    V$KLF6.01
    0.92
    328 - 346
    (+)
    1.000
    0.924
    ggagcgGGGGcggggccat

     
    V$SP1F
    V$SP1.01
    0.88
    331 - 345
    (+)
    1.000
    1.000
    gcggGGGCggggcca

     
    V$MAZF
    V$MAZR.01
    0.88
    333 - 345
    (+)
    1.000
    0.940
    gggggcGGGGcca

     
    V$HAND
    V$HAND2_E12.01
    0.75
    336 - 356
    (-)
    1.000
    0.802
    ccggccgcggaTGGCcccgcc

     
    V$DMTF
    V$DMP1.01
    0.82
    341 - 353
    (-)
    1.000
    0.847
    gccgcGGATggcc

     
    V$CTCF
    V$CTCF.01
    0.80
    342 - 368
    (+)
    1.000
    0.870
    gccatccgcggccgGGGGcggggccgg

     
    V$ZBPF
    V$ZNF219.01
    0.91
    344 - 366
    (-)
    1.000
    0.934
    ggccccgCCCCcggccgcggatg

     
    V$ZBPF
    V$ZF9.01
    0.87
    347 - 369
    (-)
    1.000
    0.975
    cccggccCCGCccccggccgcgg

     
    V$AP2F
    V$AP2.01
    0.90
    349 - 363
    (+)
    0.881
    0.910
    gcgGCCGggggcggg

     
    V$EGRF
    V$EGR1.02
    0.88
    349 - 365
    (+)
    1.000
    0.918
    gcggccggGGGCggggc

     
    V$CTCF
    V$CTCF.01
    0.80
    352 - 378
    (+)
    0.842
    0.801
    gccgggggcggggcCGGGcggggggcg

     
    V$SP1F
    V$SP1.01
    0.88
    353 - 367
    (+)
    1.000
    1.000
    ccggGGGCggggccg

     
    V$KLFS
    V$KLF6.01
    0.92
    355 - 373
    (+)
    1.000
    0.929
    gggggcGGGGccgggcggg

     
    V$MAZF
    V$MAZR.01
    0.88
    355 - 367
    (+)
    1.000
    0.931
    gggggcGGGGccg

     
    V$CTCF
    V$CTCF.01
    0.80
    357 - 383
    (+)
    1.000
    0.848
    gggcggggccgggcGGGGggcgcgcgg

     
    V$SP1F
    V$SP1.01
    0.88
    358 - 372
    (+)
    1.000
    0.898
    ggcgGGGCcgggcgg

     
    V$PLAG
    V$PLAG1.01
    0.88
    359 - 379
    (+)
    0.833
    0.902
    GCGGggccgggcggggggcgc

     
    V$PLAG
    V$PLAG1.01
    0.88
    361 - 381
    (+)
    0.958
    0.894
    GGGGccgggcggggggcgcgc

     
    V$ZBPF
    V$ZNF219.01
    0.91
    361 - 383
    (-)
    1.000
    0.984
    ccgcgcgCCCCccgcccggcccc

     
    V$SP1F
    V$SP1.01
    0.88
    363 - 377
    (+)
    1.000
    0.934
    ggccGGGCggggggc

     
    V$ZBPF
    V$ZBP89.01
    0.93
    364 - 386
    (-)
    1.000
    0.934
    caaccgcgcgCCCCccgcccggc

     
    V$EGRF
    V$WT1.01
    0.92
    365 - 381
    (+)
    0.953
    0.974
    ccgggCGGGgggcgcgc

     
    V$GLIF
    V$GLIS3.01
    0.88
    366 - 380
    (-)
    1.000
    0.896
    cgcgCCCCccgcccg

     
    V$MAZF
    V$MAZR.01
    0.88
    367 - 379
    (+)
    1.000
    0.880
    gggcggGGGGcgc

     
    V$ZF5F
    V$ZF5.01
    0.95
    372 - 382
    (+)
    1.000
    0.959
    ggggGCGCgcg

     
    V$CDEF
    V$CDE.01
    0.87
    373 - 385
    (+)
    1.000
    0.870
    ggggCGCGcggtt

     
    V$ZF5F
    V$ZF5.01
    0.95
    374 - 384
    (+)
    1.000
    0.966
    gggcGCGCggt

     
    V$CDEF
    V$CDE.01
    0.87
    375 - 387
    (+)
    1.000
    0.900
    ggcgCGCGgttgg

     
    V$MYBL
    V$CMYB.01
    0.90
    376 - 388
    (-)
    1.000
    0.902
    tcCAACcgcgcgc

     
    V$SP1F
    V$SP1.01
    0.88
    387 - 401
    (+)
    1.000
    0.910
    gaccGGGCgggagga

     
    V$EGRF
    V$CKROX.01
    0.88
    391 - 407
    (+)
    1.000
    0.902
    gggcGGGAggagcaggc

     
    V$YY1F
    V$YY1.02
    0.94
    407 - 425
    (+)
    1.000
    0.946
    ctcttCCATctcctgattg

     
    V$CLOX
    V$CDP.02
    0.94
    413 - 431
    (-)
    1.000
    0.958
    cagaccCAATcaggagatg

     
    V$CAAT
    V$NFY.01
    0.90
    416 - 430
    (-)
    1.000
    0.953
    agacCCAAtcaggag

     
    V$PAX1
    V$PAX1.01
    0.65
    424 - 442
    (-)
    0.750
    0.662
    cCCTTgcggtccagaccca

     
    V$CTCF
    V$CTCF.04
    0.85
    426 - 452
    (+)
    0.949
    0.921
    ggtctggaccgcaaggGGGCggggtct

     
    V$SMAD
    V$SMAD3.01
    0.99
    426 - 434
    (+)
    1.000
    0.996
    gGTCTggac

     
    V$ETSF
    V$FLI.01
    0.81
    428 - 448
    (+)
    0.750
    0.817
    tctggaCCGCaagggggcggg

     
    V$HOMF
    V$HMX3.01
    0.89
    430 - 448
    (+)
    0.815
    0.900
    tggaccgcAAGGgggcggg

     
    V$ZBPF
    V$ZF9.01
    0.87
    432 - 454
    (-)
    1.000
    0.966
    caagaccCCGCccccttgcggtc

     
    V$EGRF
    V$EGR1.02
    0.88
    434 - 450
    (+)
    1.000
    0.903
    ccgcaaggGGGCggggt

     
    V$SP1F
    V$SP1.01
    0.88
    438 - 452
    (+)
    1.000
    0.997
    aaggGGGCggggtct

     
    V$MAZF
    V$MAZR.01
    0.88
    440 - 452
    (+)
    1.000
    0.912
    gggggcGGGGtct

     
    V$CTCF
    V$CTCF.02
    0.69
    454 - 480
    (+)
    1.000
    0.691
    gaggggttctgcgggccGGCAttggga

     
    V$SP1F
    V$BTEB3.01
    0.93
    489 - 503
    (+)
    0.888
    0.956
    aggagGGCGtggtaa

     
    V$CREB
    V$ATF2.01
    0.87
    500 - 520
    (+)
    0.777
    0.886
    gtaataTGAAgtcagttccgg

     
    V$CP2F
    V$CP2.02
    0.84
    504 - 522
    (-)
    0.875
    0.840
    aACCGgaactgacttcata

     
    V$ETSF
    V$ELK1.02
    0.91
    506 - 526
    (-)
    1.000
    0.978
    caccaaccGGAActgacttca

     
    V$MYBL
    V$CMYB.02
    0.96
    513 - 525
    (-)
    0.989
    0.966
    acCAACcggaact

     
    V$PARF
    V$TEF.01
    0.85
    517 - 533
    (+)
    1.000
    0.853
    ccggttggtGTAAaacc

     
    V$CTCF
    V$CTCF.02
    0.69
    525 - 551
    (+)
    0.750
    0.740
    tgtaaaacccccggggcGGCGgcgaac

     
    V$ZBPF
    V$ZF9.01
    0.87
    528 - 550
    (-)
    1.000
    0.924
    ttcgccgCCGCcccgggggtttt

     
    V$EGRF
    V$EGR1.02
    0.88
    533 - 549
    (+)
    0.789
    0.886
    ccccggggCGGCggcga

     
    V$SP1F
    V$SP1.01
    0.88
    534 - 548
    (+)
    1.000
    0.911
    cccgGGGCggcggcg

     
    V$HEAT
    V$HSF2.02
    0.95
    556 - 580
    (-)
    1.000
    0.991
    acaccgcgacccAGAAgcatctaaa

     
    V$CP2F
    V$CP2.01
    0.90
    565 - 583
    (+)
    1.000
    0.902
    ttCTGGgtcgcggtgtgct

     
    V$GREF
    V$GRE.01
    0.85
    567 - 585
    (+)
    0.833
    0.856
    ctgggtcgcggtGTGCtaa

     
    V$GREF
    V$GRE.02
    0.82
    567 - 585
    (-)
    0.890
    0.824
    ttaGCACaccgcgacccag

     
    V$CDEF
    V$CDE.01
    0.87
    569 - 581
    (+)
    1.000
    0.940
    gggtCGCGgtgtg

     
    V$RBP2
    V$PLU1_JARID1B.01
    0.96
    574 - 582
    (-)
    1.000
    0.967
    GCACaccgc

     
    V$PAX8
    V$PAX8.01
    0.88
    603 - 615
    (-)
    1.000
    0.890
    ctcTCAAgctcac

     
    V$EBOX
    V$MYCMAX.03
    0.91
    613 - 625
    (+)
    1.000
    0.941
    gagccgCGCGcta

     
    V$PAX5
    V$PAX5.02
    0.73
    613 - 641
    (+)
    1.000
    0.752
    gagccgcgcgctagAGCGacccggcgagg

     
    V$CDEF
    V$CDE.01
    0.87
    615 - 627
    (+)
    1.000
    0.890
    gccgCGCGctaga

     
    V$NRF1
    V$NRF1.01
    0.78
    616 - 632
    (-)
    0.750
    0.821
    gtcGCTCtagcgcgcgg

     
    V$NRF1
    V$NRF1.01
    0.78
    617 - 633
    (+)
    1.000
    0.826
    cgcGCGCtagagcgacc

     
    V$CP2F
    V$TCFCP2L1.01
    0.87
    620 - 638
    (-)
    0.926
    0.886
    cgCCGGgtcgctctagcgc

     
    V$EREF
    V$ER.03
    0.81
    645 - 663
    (+)
    1.000
    0.833
    ggcggccaccggGACCgcg

     
    V$CTCF
    V$CTCF.01
    0.80
    663 - 689
    (+)
    0.842
    0.842
    ggccgccgcagccaCGGGcaggctcct

     
    V$CTCF
    V$CTCF.04
    0.85
    666 - 692
    (+)
    0.857
    0.850
    cgccgcagccacgggcAGGCtcctgct

     
    V$EBOX
    V$MYCMAX.03
    0.91
    671 - 683
    (+)
    0.842
    0.939
    cagccaCGGGcag

     
    V$EBOX
    V$USF.03
    0.89
    672 - 684
    (-)
    1.000
    0.894
    cctgccCGTGgct

     
    V$MYOD
    V$MYF5.01
    0.90
    689 - 705
    (-)
    1.000
    0.903
    caccagCAGCagaagca

     
    V$MYOD
    V$MYF5.01
    0.90
    692 - 708
    (-)
    1.000
    0.924
    ccccacCAGCagcagaa

     
    V$CREB
    V$TAXCREB.01
    0.81
    704 - 724
    (+)
    0.784
    0.846
    tggggcTCACggcgcctgcct

     
    V$CP2F
    V$CP2.02
    0.84
    711 - 729
    (+)
    0.833
    0.874
    cACGGcgcctgccttggcg

     
     

    Scott
    Scott's picture
    Wow Wow

    Wow Wow
    Have never seen better responses in my life!!

    Fraser Moss
    Fraser Moss's picture
    crisspy

    crisspy
    Did you get alll the answers you needed from these replies?  Is there anyting else you need help with?
    Please let us know how your research has progressed since your initial post
    Thanks!

    Fraser Moss
    Fraser Moss's picture
    Transcription factors

    Transcription factors associated with APLP2 (gene id 334)

    No.
    TF gene
    Gene ID
    Citations

    1
    APBB3 / amyloid beta (A4) precursor protein-binding, family B, member 3
    10307
    PMID:9461550

    2
    CTNNB1 / catenin (cadherin-associated protein), beta 1, 88kDa
    1499
    PMID:16645641

    3
    ID2 / inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
    3398
    PMID: 11501497

    4
    KAT5 / K(lysine) acetyltransferase 5
    10524

    PMID: 17920016
    PMID: 14699153
    PMID: 12563035

    5
    NFKB1 / nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
    4790
    PMID: 14597230

    6
    TFCP2 / transcription factor CP2
    7024
    PMID: 16645641

    7
    TP53 / tumor protein p53
    7157

    PMID: 17908046
    PMID: 16763046

     

    andrewz
    andrewz's picture
    Very interesting, I did what

    Very interesting, I did what you said, and it is not working for me, why?
    I am working with gene

    Normal
    0

    false
    false
    false

    MicrosoftInternetExplorer4

    /* Style Definitions */
    p.MsoNormal, li.MsoNormal, div.MsoNormal
    {mso-style-parent:"";
    margin:0in;
    margin-bottom:.0001pt;
    mso-pagination:widow-orphan;
    font-size:12.0pt;
    font-family:"Times New Roman";
    mso-fareast-font-family:"Times New Roman";}
    @page Section1
    {size:8.5in 11.0in;
    margin:1.0in 1.25in 1.0in 1.25in;
    mso-header-margin:.5in;
    mso-footer-margin:.5in;
    mso-paper-source:0;}
    div.Section1
    {page:Section1;}
    -->

    /* Style Definitions */
    table.MsoNormalTable
    {mso-style-name:"Table Normal";
    mso-tstyle-rowband-size:0;
    mso-tstyle-colband-size:0;
    mso-style-noshow:yes;
    mso-style-parent:"";
    mso-padding-alt:0in 5.4pt 0in 5.4pt;
    mso-para-margin:0in;
    mso-para-margin-bottom:.0001pt;
    mso-pagination:widow-orphan;
    font-size:10.0pt;
    font-family:"Times New Roman";
    mso-ansi-language:#0400;
    mso-fareast-language:#0400;
    mso-bidi-language:#0400;}

    NM_021127.2

    The FFM
    The FFM's picture
     Just enter NM_021127

     Just enter NM_021127

     
    Prom ID
    Type
    Chr.
    Strand
    1st exon start
    1st exon end
    1st acceptor site
    distance to gene
    Gene ID
    Query ID
    Species

    EP74612
    EPD
    chr18
    +
    55718208
    55718446
    55720858
    8
    hchr18_00001
    NM_021127
    Human
     

    rahulgarhwal
    rahulgarhwal's picture
     Hi Frasermoss, I was trying

     Hi Frasermoss, I was trying to run some analysis with (NG_008099.1) to see if I could find its promoter region I know this sequence hits on Chromosome#1 between 19138938 and ends at 2389765 but somehow I'm not able to extract its upstream promoter sequence from Chromosome 1 using your suggestion. It would be awesome if I can save some time on "Edit Sequence"
    Thanks a lot

    Fraser Moss
    Fraser Moss's picture
    Try TRED at http://rulai.cshl

    Try TRED at http://rulai.cshl.edu/cgi-bin/TRED/tred.cgi?process=searchPromForm

    Search Homo Sapiens Gene name "LBR"
    results

    Gene ID
    Gene Name
    Species
    Chromosome Location
    Strand
    Promoter ID
    Quality
    Transcription Start Site

    1565

     


     

    LBR human, Homo sapiens

    1q42.1

    - 2300

    2: known

    222023181   1565 LBR human, Homo sapiens 1q42.1 - 2301 2: known 222023961 1565 LBR human, Homo sapiens 1q42.1 - 2302 3.1: refseq,predicted 222026626 1565 LBR human, Homo sapiens 1q42.1 - 114540 3.2: refseq 221996650

    Promoter IDs

    Accession Number
    2300

    Gene
    LBR

    Species
    human, Homo sapiens

    Chromosome
    1

    Strand
    -

    Transcription Start Site
    222023181

    First Exon End

    First Intron End

    -->

    Quality
    2: known - stated explicitly in GenBank records

    References

    • [1] GenBank Nucleotide: NM_002296
      Homo sapiens lamin B receptor (LBR), transcript variant 1, mRNA.

    Sequence

    AGCATCTCGGGTAACAACCGAGCCCCTCCTCGCAGCGTAAGTCGTAGGAG    -651
    CCCTCGGCCATTCTTCCCCCTCCCTCCCGCCGCCGGTCCCAGCATCGGTC    -601
    CGGGTTCGCTTCTACGCAGGTTCAGCGGCCGCGGACACAAAAGCGCCCCT    -551
    GCTCGCCTTCGATGCCGCTGCTTGGTCCAGGGGCTTCTGTGGGATTTTAA    -501
    CACGCTAAGGAGGGCACTCATAGTGTTTTACCGAGAAACGCTTTCGAGCT    -451
    CGGATCTTTGGTGATCACTTCAAGAATGTATTAGTTTTCTTTGTAGCTTA    -401
    AAAAAAAATCTCGTTCGCCAAGCCACCTGGCACCCCAAACACTGCTGCGA    -351
    GCGCTGGGAGGGAAAGGGCGGGAGCGCGCGGGCTCCGTGTGCTGCGAGGG    -301
    CGCCTGGGCGGCTGAGATAAGGCGGTGGCAAACGTCGCGCTCCGGGCCGC    -251
    CCCGCCAGACTCGGTTTCCCCCGCTCACCGGCCTCCCCGCCCCCAGGCAG    -201
    GGTGGGGCGGGGCGGACGCGCCACGGCGCGCGACCAATCGACAGCGCCGG    -151
    GGATGATTCAAAAGGTCGAGGAGCCAATGGGAGCCCCGGGCGGCCTCGCC    -101
    GGTGGGGAGGGGAGGCGAGGGGAGGGGAGAAGCGCCGCGAGGCGGGGCCG     -51
    GGGAGGCGCGCGCCCGGCTTGCGGGACTGCGGGGCGCGAGAGCGCGGCCG      -1
    GGTAGCGTCGCGCGCGTGGATCTGCCGCCGGGTTGCTGTGCGACTATTCT      49
    CCGGGAGCCGTCCGTGTCACCGCCGGAACCTGGCGCAGGTGAGTGCTTCC      99
    ACCCCCGCCCTGCTCCCAGCTCCCCGCGGCGCGTTCTTCGAGGGGCCGCT     149
    GGGGGAGGAAGCCCGAGGCCGGCGCAGCGGCCGGGCCGGGGACCCTGGGC     199
    GCGGGGCCTGGCGCGGCGGCCTTCCCCTCCTCTCCTCGCCTCCTCGTCTC     249
    CTCCCCTCCTCGCCTTTTCTGGCCCAGTCGGGTGGTCGGGGCGGCGGCGG     299

    Accession Number
    2301

    Gene
    LBR

    Species
    human, Homo sapiens

    Chromosome
    1

    Strand
    -

    Transcription Start Site
    222023961

    First Exon End

    First Intron End

    -->

    Quality
    2: known - stated explicitly in GenBank records

    References

    • [1] GenBank Nucleotide: NM_002296
      Homo sapiens lamin B receptor (LBR), transcript variant 1, mRNA.
    • [2] Database of Transcriptional Start Sites: DBTSS:NM_002296
      DBTSS

    Sequence

    AAAGAATAGTGTAGCACTCACTGCTTGGCTATTTGGGATAGGATCTGTCT    -651
    TAGGTCCCCATAAGCGCTTTTATTTCTGTGTAATTTACTGCAAAACTCTA    -601
    TGAGGTAGGACTAATATTATCTTATGTCAAGGGTTAAGACAATTGAGACT    -551
    TGGGGGTTTGTCAAAAATAAAAGATTTTCTGACTTTGGAGTGCGATGTGC    -501
    ATTTCTGTTGCACAGATCTCCACCAAGGGCAAATTCGATGGCAATGACAA    -451
    TTTGATGTCAGAACTTCTCAGGAAAGGCTCTGATGAACTCATTCACACTG    -401
    CATGTGAATGACTGAGAAAACTCGATGTATTTTCACTTTTTTTTTTTTAA    -351
    GAAGTAAACCTGGGTGTTTTGTAGTTCTATGAGAAAATGAAAGCTGAAGC    -301
    TAGGCTATAGATGAAAAGTTCTATTCATTATTACAATTTAATAATGCTTC    -251
    CAAAATAGCAATTCACTTAAATATACCTAGTTAGGGTGTTAAGAAATACT    -201
    TTGATTAAAACCACACTGCAAAATAGGGAACTTCAATGGACTGCTTTAAA    -151
    CTCTCGACCTCAAAGGAAGGAAATCAACTAACCGATAATGAAAACTAGCA    -101
    GAAAAAAAAAAGCTTAGGATCCGTAACAGATTCGGAGTCAACAATGACAT     -51
    GACTCAGCATTTTGGGGTTCAATTAAAACCAGGCTTGTAGGTTGCAGGTC      -1
    AAGTTGTGTTTCGGTGTGTAACGCATAAAACTTCTTGTTCCACGCTCCGC      49
    GGTGTTGGGGATTTTCTACTGCATCTCGACAGCATCTCGGGTAACAACCG      99
    AGCCCCTCCTCGCAGCGTAAGTCGTAGGAGCCCTCGGCCATTCTTCCCCC     149
    TCCCTCCCGCCGCCGGTCCCAGCATCGGTCCGGGTTCGCTTCTACGCAGG     199
    TTCAGCGGCCGCGGACACAAAAGCGCCCCTGCTCGCCTTCGATGCCGCTG     249
    CTTGGTCCAGGGGCTTCTGTGGGATTTTAACACGCTAAGGAGGGCACTCA     299

    Accession Number
    2302

    Gene
    LBR

    Species
    human, Homo sapiens

    Chromosome
    1

    Strand
    -

    Transcription Start Site
    222026626

    First Exon End
    222026486

    First Intron End

    -->

    Quality
    3.1: refseq,predicted - associated with Refseq, TSS is predicted

    References

    • [1] GenBank Nucleotide: NM_002296
      Homo sapiens lamin B receptor (LBR), transcript variant 1, mRNA.

    Sequence

    CCTTGAGCTGGACACAGAGTGCTGATTGGTGTATTTACAATCCCTTAGCT    -651
    AGACATAAAGGTTCTCCAAGTCCCTGCTAGATTAGCTAGACACAGAGCAC    -601
    TGATTGGTGCACTTACAAACCTTGAGCTAGACACAGGGGGCTGATTGGTG    -551
    TGTTCACAAACCCTGAGCAAGACACAGAGTGCTGACTGGTGTATTTACAA    -501
    TCCCTTAGCTAGACATAAAGTTTCTCCAAGTCCCCACCAGATTAGCTAGA    -451
    TACACAGTGCTGATTGGTGCATTTACAAACCTTGAGCTAGACACAGAGTG    -401
    CTGATTGGTGTATTTACAATCCCTTAGCTAGACATAAAGGTTCTCCAAGT    -351
    CCCCGCTAGACCCAGGAGCCCAGCTGGCTTCACCTAGTGGATCCTGCATC    -301
    AGGGAGCCCGCCAGTCCCACGACCTGTGCCCACACTACTCCTCAGCCCTT    -251
    GGGCGGTCGGAATGGGACCGGGCGCGTGGAGCAGGGGGCAGCGCTCATCT    -201
    GGGAGGCTCAGGCCGCTCAGGAGCCCATGGTGTGGGGGAGGCTCAGGCAT    -151
    GGCAGGCTGCAGGTCCCCAGCCTTTCCCTGCGGGGAGGCAGCTGAGGTCC    -101
    AGCGAGAATTCCAGCACAGCGCTGGTGGGCCAGGCCGGCACTGCTGGGAG     -51
    ACCCAGCGCATCCTCCGCAGCTGCTGGCCTGGGTACTAAGCCCCTCACTG      -1
    CCTGGGGCCTGCGGAACCGGCCAGCCGCTCCGAGTGCGGGGCCTGCCGAG      49
    CCCACGCCCACCTGGAACTTGCACTGGCCTGCAAGCCCAGTGCTCAGCCC      99
    TGGTTCCCACCCACGCCTGTCCCTCCACACCTCCCCGCAAGGTGAGGGAG     149
    CCCGCTCCGGCCTCGGCCAGCCCAGAGAGGGGCTCCCACAGTGCAGTGGC     199
    AGGCTGAAGGGCTCCTCAAGAGCGGCCAGAGTGGGCGCCGAGGCCGAGGA     249
    GGTGCAGAGAGTGAGCGAGGGCTGCTAGGGCTGCCAGCACGCTGTCACCT     299

    Accession Number
    114540

    Gene
    LBR

    Species
    human, Homo sapiens

    Chromosome
    1

    Strand
    -

    Transcription Start Site
    221996650

    First Exon End
    221998603

    First Intron End
    221999542

    -->

    Quality
    3.2: refseq - associated with Refseq, take Refseq start as TSS

    References
     

    Sequence

    CTTTATATTTACCAAACCTGACTCCCTGTAAAGGAGTGCTGTCTTAAAAA    -651
    CAACTGAAGGGGTTAAAGTCGTTTCTTTTAGTTTAATAGATGTGCATAAG    -601
    GTAGCTTTAGCAATTAAATTCTAGTGAAGTTGATATAGTCTCATTTTTAA    -551
    TTGTCCTGTAATGGAACAGTAGCAAATTCACTAAACTTTTGTGTTCAGAG    -501
    TTAAATTGTTCTCAGTACTTTCAATGTAGGGGAATGTAATAAACATAGTG    -451
    TGTATGTTTGGGTTTTAATTACACATTTTATATATGAGCCATTTAGATAT    -401
    GCAGTGTTAATTCTATACTGCATTTGAAGTGTATGTAACTTAGCTTATGT    -351
    TAATGCAGTCATGAAGTTGGTTTGCTCCAGCATCCGGTAGTCTTTAAACA    -301
    TTCTTTTAGTGAAATTGTCATTGTTTTATCAGTGCTAATGTGTGCAAGCA    -251
    GTTTTTTTATTTTGCTTTTCTCCTGGCATCAGAAAGTGGTGGCGTTTTCT    -201
    GTACTGGATTGCACCAAGGAAGCTTTTGGGGAGGAAGGAAGGACATTAAA    -151
    TTCTTTCCCTGGTAATGAAAAGAGCCCTTTATCAATACAGTGCTGCAATT    -101
    TCTGGATATCAGCTACACTTTGTTTTTAAGTTTGTTTTTGACATGTTTAT     -51
    TTGGCAAATTTTATAATGAAGTTTTAAGTTGAAAATAAAATGTAGCAACA      -1
    TTTTGATCACTTTGGAGCCTTTTTTTTTTCCCTTTCTTGCTTGAAACTGA      49
    GATTTTTGGGACCAAGACAGGAGCCCTTAGATTCCCACCCCTGCCCAGCC      99
    TCCTGTTTTCCTAGGATCATCTGTTTGGGACCCCTGGCCAACTGCTGTTT     149
    AAAACTCTCAGAATGTTGGAACTCAAAGGGGTTAGTTGGGAATCCTAACT     199
    CCCAGAAAATGGTCATGTGTTTAGTATTTGCTGTTTGAGAAAATACAGAA     249
    ATGCTAAAACTATTGTAGATCCAGTCATACTTTCAAATGCATTTGTATGA     299

    Kmay
    Kmay's picture
    Rahulgarhwal,

    Rahulgarhwal,

    LBR has 8 transcripts:

    Loci
    Promoter Selection
    Transcript

    Homo sapiens
    LBR / lamin B receptor
    GXL_106551 / GeneID:3930
    Chromosome 1 / NC_000001 (-)
    More Gene Info

    GXP_128034
    223669235 - 223669835 (601 bp)

    Analyze for binding sites
     
    1: GXT_2767708 (1 exon)
    AK125116
    TSS = 501
    less relevant transcript

    GXP_128035
    223682225 - 223682937 (713 bp)
    conserved in 6 of 11 orth. loci , supported by 111 CAGE tags
    4 relevant transcripts
    Analyze for binding sites
     
    2: GXT_2837749 (14 exons)
    NM_002296
    TSS = 531

     
    3: GXT_21916425 (14 exons)
    AK222834
    TSS = 613

     
    4: GXT_22783751 (14 exons)
    AK312258
    TSS = 559

     
    5: GXT_23211257 (8 exons)
    AK303589
    TSS = 560

    GXP_128036
    223683042 - 223683753 (712 bp)
    conserved in 5 of 11 orth. loci , supported by 2 CAGE tags
    1 relevant transcript
    Analyze for binding sites
     
    6: GXT_2837750 (14 exons)
    NM_194442
    TSS = 612

    GXP_1490667
    223664733 - 223665347 (615 bp)
    conserved in 8 of 11 orth. loci , supported by 2 CAGE tags
    1 relevant transcript
    Analyze for binding sites
     
    7: GXT_22817840 (5 exons)
    AK089042 (from mmu)
    TSS = 513

    GXP_1818874
    223678200 - 223678917 (718 bp)
    conserved in 11 of 11 orth. loci
    1 relevant transcript
    Analyze for binding sites
     
    8: GXT_23226485 (13 exons)
    XM_514234 (from ptr)
    TSS = 501

    with 5 distinct promoter regions
    6551
    ("LBR")
    found on:

    Homo sapiens
    NCBI build 36
    Chromosome 1
    Contig NC_000001

    Locus
    Selection
    Promoter
    Transcript/TSS

    lamin B receptor
    LBR (GeneID:3930)
    GXL_106551

    GXP_128034 (-)
    223669235-223669835 (601 bp)

    Analyze for binding sites
     
    GXT_2767708 (1 exon)
    AK125116
    TSS = 501
    less relevant transcript

    GXP_128035 (-)
    223682225-223682937 (713 bp)
    conserved in 6 of 11 orth. loci , supported by 111 CAGE tags
    4 relevant transcripts
    Analyze for binding sites
     
    GXT_21916425 (14 exons)
    AK222834
    TSS = 613

     
    GXT_22783751 (14 exons)
    AK312258
    TSS = 559

     
    GXT_23211257 (8 exons)
    AK303589
    TSS = 560

     
    GXT_2837749 (14 exons)
    NM_002296
    TSS = 531

    GXP_128036 (-)
    223683042-223683753 (712 bp)
    conserved in 5 of 11 orth. loci , supported by 2 CAGE tags
    1 relevant transcript
    Analyze for binding sites
     
    GXT_2837750 (14 exons)
    NM_194442
    TSS = 612

    GXP_1490667 (-)
    223664733-223665347 (615 bp)
    conserved in 8 of 11 orth. loci , supported by 2 CAGE tags
    1 relevant transcript
    Analyze for binding sites
     
    GXT_22817840 (5 exons)
    AK089042 (from mmu)
    TSS = 513

    GXP_1818874 (-)
    223678200-223678917 (718 bp)
    conserved in 11 of 11 orth. loci
    1 relevant transcript
    Analyze for binding sites
     
    GXT_23226485 (13 exons)
    XM_514234 (from ptr)
    TSS = 501

    3 of which share complex regulatory pattern:

     
    Element
    Strand
    Matrix sim.
    Distance to next element
    Common to

    1
    V$SORY
    +
    Optimized (min. 0.80)
    109 - 115 bp
    4 matches in 3 seq. (60 %), 3 non-overlapping

    2
    V$BRNF
    +
    Optimized (min. 0.81)
    67 - 74 bp

    3
    V$SORY
    +
    Optimized (min. 0.77)
    55 - 56 bp

    4
    O$VTBP
    +
    Optimized (min. 0.84)
    ---

    You can register for free test access at
    http://www.genomatix.de/cgi-bin/UMapps/register.pl

    Hope this helps!

    Cheers

    Klaus

    Bioinfo_himi
    Bioinfo_himi's picture
     hello ....

     hello ....

    I am working on gene calreticulin of triticum aestivum and its Accesion no  GenBank: EF452301.1 

    The information I need for this gene is:

    1) How to locate promoter of this gene? and how to extract that promoter region?

    2) What kind of proteins/transcription factors can bind to the promoter of this gene?

    I really don't knw how to find out about information. i really need help

    Thanks in advance